Bilgi

Proteinler fosfor içerir mi? Eğer bu doğruysa, o zaman alfred hershey ve martha Chase proteinlerin fosfor içermediği ifadesini nasıl kullanmıştır?

Proteinler fosfor içerir mi? Eğer bu doğruysa, o zaman alfred hershey ve martha Chase proteinlerin fosfor içermediği ifadesini nasıl kullanmıştır?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Fosforun belirli bir proteinin bir bileşeni olduğunu duydum, ancak hiçbir amino asitte fosfor olmadığını biliyoruz… ve eğer bu doğruysa, o zaman Alfred hershey ve Martha Chase deneyinin temeli "protein yok" olan Alfred Hershey ve Martha Chase deneyi nasıl alkışlandı? fosfor var"??


Evet, proteinlerin bir kısmı fosfor içerir ancak deneyde (Hershey ve Chase deneyi) bakteriyofaj kullanmışlar, protein kılıfı karbon, hidrojen, azot ve kükürt içerirken bakteriyofajdaki DNA karbon, hidrojen, azot ve fosfor (asit içinde) içerir. bu yüzden bunu deney için seçtiler üstelik DNA'da kükürt yok ama fosfor yok yani aktarılan şeyin DNA olduğu sonucuna varılabilir Referans:NCERT


Evet, amino asitlerin hiçbiri yan zincirinde fosfor içermez, ancak translasyon sonrası modifikasyon sırasında eklenir. Bu, proteinlerin stabilitesine ve düzgün çalışmasına yardımcı olur. (Via:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3415839/.

Fosfor, proteinlerin değil nükleik asidin ana yapı taşı olduğundan, yeni bakteriyofaj üretiminde kullanılması, nükleik asit sentezinde fosfor kullanımını temsil edecektir. Hershey ve Chase, blender deneyini kullanarak bakteriyofajın protein kaplamasını çekirdeklerinden ayırdı. Sonra bu nükleik asidi bakterilere soktu ve yeni virüsleri sentezlemek için çoğalabildiğini buldu. Ve bu, nükleik asidin genetik bilginin iletilmesinden sorumlu olduğunu kanıtladı.
(Şu adresten: https://embryo.asu.edu/pages/hershey-chase-experiments-1952-alfred-hershey-and-martha-chase)


Hiçbir amino asidin fosfor içermediği doğrudur, ancak translasyon sonrası modifikasyonlar nedeniyle bazı proteinler fosforile edilebilir. Ek olarak, nispeten inaktif protein olan glikojen fosforilaz b gibi enzimatik proteinler vardır ve aktif formlara (glikojen fosforilaz a) değişim, fosforilaz kinazın etkisiyle gerçekleştirilebilir (Lehninger. Principles of Biochemistry. 5. Baskı). .)


Samacheer Kalvi 12. Biyo Zooloji Moleküler Genetik Ders Kitabı Geri Sorular ve Cevaplar

Soru 1.
Bakteriyofaj ile Hershey ve Chase deneyi gösterdi ki
(a) Protein bakteri hücrelerine girer
(b) DNA genetik materyaldir
(c) DNA radyoaktif kükürt içerir
(d) Virüsler dönüşüme uğrar
Cevap:
(b) DNA genetik materyaldir

Soru 2.
DNA ve RNA birbirine benzer
(a) Azot bazı olarak timin
(b) Tek iplikli bir sarmal şekli
(c) Nükleotid içeren şekerler, nitrojen bazları ve fosfatlar
(d) Amino asit fenil alanin için aynı nükleotid dizisi
Cevap:
(c) Nükleotid içeren şekerler, nitrojen bazları ve fosfatlar

Soru 3.
Bir mRNA molekülü tarafından üretilir
(a) Çoğaltma
(b) Transkripsiyon
(c) Çoğaltma
(d) Tercüme
Cevap:
(b) Transkripsiyon

Soru 4.
İnsan genomundaki toplam azotlu baz sayısının yaklaşık olduğu tahmin edilmektedir.
(a) 3.5 milyon
(b) 35000
(c) 35 milyon
(d) 3,1 milyar
Cevap:
(d) 3,1 milyar

Soru 5.
15N ortam üzerinde büyütülen E. coli hücresi, 14N ortama aktarılır ve iki nesil boyunca büyümesine izin verilir. Bu hücrelerden ekstrakte edilen DNA, bir sezyum klorür yoğunluk gradyanında ultrasantrifüjlenir. Bu deneyde DNA'nın hangi yoğunluk dağılımını beklersiniz?
(a) Bir yüksek ve bir düşük yoğunluklu bant
(b) Bir ara yoğunluk bandı
(c) Bir yüksek ve bir orta yoğunluk bandı
(d) Bir düşük ve bir orta yoğunluk bandı
Cevap:
(d) Bir düşük ve bir orta yoğunluk bandı

Soru 6.
DNA moleküllerinin önde gelen ve gecikmeli zincirinin sentezindeki farkın temeli nedir?
(a) Replikasyonun kaynağı moleküllerin sadece 5' ucunda gerçekleşir.
(b) DNA ligazı sadece 3' → 5' yönünde çalışır
(c) DNA polimeraz, yeni nükleotidlere yalnızca büyüyen standın 3' ucuna kadar katılabilir.
(d) 5' ucunda çalışan sarmallar ve tek iplikli bağlayıcı proteinler
Cevap:
(d) 5' ucunda çalışan sarmallar ve tek iplikli bağlayıcı proteinler

7. soru
Aşağıdakilerden hangisi merkezi dogma ile ilgili doğru olay dizisidir?
(a) Transkripsiyon, Tercüme, Çoğaltma
(b) Transkripsiyon, Çoğaltma, Tercüme
(c) Çoğaltma, Tercüme, Transkripsiyon
(d) Çoğaltma, Transkripsiyon, Çeviri
Cevap:
(d) Çoğaltma, Transkripsiyon, Çeviri

Soru 8.
DNA replikasyonu ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
(a) DNA molekülünün çözülmesi, hidrojen bağları koptuğunda meydana gelir.
(b) Çoğaltma, her bir baz tam olarak kendisine benzeyen başka bir bazla eşleştirildiğinde gerçekleşir.
(c) Proses, yeni molekülde eski bir iplik korunduğu için yarı konservatif replikasyon olarak bilinir.
(d) Tamamlayıcı baz çiftleri hidrojen bağlarıyla bir arada tutulur
Cevap:
(b) Çoğaltma, her bir baz tam olarak kendisine benzeyen başka bir bazla eşleştirildiğinde gerçekleşir.

Soru 9.
Ökaryotlarda DNA replikasyonu ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
(a)) Çoğaltma, tek bir çoğaltma kaynağında başlar.
(b) Çoğaltma, kökenlerden iki yönlüdür.
(c) Replikasyon, dakikada yaklaşık 1 milyon baz çiftinde gerçekleşir.
(d) Her birinde aynı anda meydana gelen replikasyon ile çok sayıda farklı bakteri kromozomu vardır.
Cevap:
(d) Her birinde aynı anda meydana gelen replikasyon ile çok sayıda farklı bakteri kromozomu vardır.

Soru 10.
Şifresi çözülecek ilk kodon, hangi kodun şifrelendiğiydi.
(a) AAA, prolin
(b) GGG, alanin
(c) UUU, Fenilalanin
(d) TTT, arginin
Cevap:
(c) UUU, Fenilalanin

Soru 11.
Meselson ve Stahl'ın deneyi kanıtladı __________
(a) İletim
(b) Dönüşüm
(c) DNA genetik materyaldir
(d) DNA replikasyonunun yarı muhafazakar doğası
Cevap:
(d) DNA replikasyonunun yarı muhafazakar doğası

Soru 12.
Ribozomlar iki alt birimden oluşur, bir ribozomun daha küçük alt biriminin bir bağlanma yeri vardır ve daha büyük alt birimin iki bağlama yeri vardır.
Cevap:
mRNA, tRNA

Soru 13.
Anoperonisa:
(a) Gen ifadesini baskılayan protein
(b) Gen ifadesini hızlandıran protein
(c) İlgili işleve sahip yapısal genler kümesi
(d) Diğer genleri açıp kapatan gen
Cevap:
(d) Diğer genleri açıp kapatan gen

Soru 14.
Kültür ortamında laktoz bulunduğunda:
(a) Dantelli, lac z, lac a genlerinin transkripsiyonu gerçekleşir
(b) Baskılayıcı, operatöre bağlanamıyor
(c) Baskılayıcı, operatöre bağlanabilir
(d) Hem (a) hem de (b) doğrudur
Cevap:
(d) Hem (a) hem de (b) doğrudur

Soru 15.
Sebepler verin: Genetik kod 'evrensel'dir.
Cevap:
Genetik kod evrenseldir. Bu, bilinen tüm canlı sistemlerin nükleik asitleri kullandığı ve aynı üç baz kodonun (üçlü kodon) amino asitlerden protein sentezini yönlendirdiği anlamına gelir. Örneğin, mRNA (UUU) kodonu, tüm organizmaların tüm hücrelerinde fenilalanin için kodlar. Prokaryotik, mitokondriyal ve kloroplast genomlarında bazı istisnalar bildirilmiştir. Ancak benzerlikler farklılıklardan daha yaygındır.

Soru 16.
Verilen transkripsiyon biriminde 'A' ve 'B' olarak işaretlenen bölümleri adlandırın:
Cevap:

Soru 17.
– Öncü diziyi ve gecikmeli diziyi ayırt edin
Cevap:

  1. DNA polimeraz I İlgili DNA onarım mekanizması
  2. DNA polimeraz II İlgili DNA onarım mekanizması
  3. DNA polimeraz III DNA replikasyonunda yer alır

Soru 18.
– Şablon dizisini ve kodlama dizisini ayırt edin.
Cevap:

  1. Şablon Zinciri: Replikasyon sırasında, 3' → 5' polaritesine sahip DNA ipliği, şablon iplik olarak işlev görür.
  2. Kodlama Dizisi: Replikasyon sırasında 5' → 3' polaritesine sahip DNA dizisi kodlama dizisi görevi görür.

Soru 19.
İnsan genomunda tanımlanan tek nükleotid polimorfizminin (SNP'ler) biyolojik ve tıp biliminde devrim niteliğinde değişiklik getirebileceği iki yoldan bahsedin.
Cevap:
Bilim adamları, insanlarda tek baz DNA farklılıklarının (SNP'ler – Tek nükleotid polimorfizmi – 'snips' olarak telaffuz edilir) meydana geldiği yaklaşık 1,4 milyon konum belirlediler. 'SNIPS'in tanımlanması, hastalıkla ilişkili diziler için kromozomal konumların bulunmasında ve insanlık tarihinin izlenmesinde yardımcı olur.

Soru 20.
İnsan genom projesinin herhangi üç hedefini belirtin.
Cevap:

  1. İnsan DNA'sındaki tüm genleri (yaklaşık 30000) tanımlayın.
  2. İnsan DNA'sını oluşturan üç milyar kimyasal baz çiftinin sırasını belirleyin.
  3. Bu bilgileri veritabanlarında saklamak için.

Soru 21.
E.coli'de laktoz varlığında üç enzim 0-galaktosidaz, permeaz ve transasetilaz üretilir. Laktoz yokluğunda enzimlerin neden sentezlenmediğini açıklayın.
Cevap:
Laktoz yokluğunda, baskılayıcı protein operatöre bağlanır ve yapısal genin RNA polimeraz tarafından transkripsiyonunu engeller, dolayısıyla enzimler üretilmez. Bununla birlikte, laktoz yokluğunda bile her zaman minimum düzeyde lac operon ifadesi olacaktır.

22. soru
Yapısal gen, düzenleyici gen ve operatör geni arasında ayrım yapar.
Cevap:
Operonun yapısı: Her operon, bir gen ekspresyonu ve düzenleme birimidir ve bir veya daha fazla yapısal genden ve yapısal genin transkripsiyonel aktivitesini kontrol eden bitişik bir operatör geninden oluşur.

  1. Yapısal gen, hücrenin ihtiyaç duyduğu proteinler, rRNA ve tRNA'yı kodlar.
  2. Promotörler, RNA sentezini başlatan DNA'daki sinyal dizileridir. RNA polimeraz, transkripsiyonun başlamasından önce promotöre bağlanır.
  3. Operatörler, promotörler ve yapısal genler arasında bulunur. Baskılayıcı protein, operonun operatör bölgesine bağlanır.

23. soru
E-coli'de her zaman düşük düzeyde bir lac operon ekspresyonu meydana gelir. Açıklamayı gerekçelendirin.
Cevap:
Lak operon tarafından sentezlenen enzimlerden biri, laktozun hücrelere taşınmasında rol oynayan permeazdır. Lac operon inaktive olursa, permeaz sentezlenmez, dolayısıyla laktoz hücreye giremez. Laktoz, bir indükleyici görevi görür, baskılayıcı proteine ​​bağlanır ve gen ekspresyonunu başlatmak için operatörü açar.

Soru 24.
İnsan genom projesine neden mega proje deniyor?
Cevap:
Uluslararası insan genom projesi 1990 yılında başlatıldı. Bu mega bir projeydi ve tamamlanması 13 yıl sürdü. İnsan genomu, bugüne kadar dizilen herhangi bir organizmanın genomundan yaklaşık 25 kat daha büyüktür ve tamamlanan ilk omurgalı genomudur. İnsan genomunun yaklaşık 3 > 109 bp'ye sahip olduğu söylenmektedir. HGP, biyolojide biyoinformatik adı verilen yeni bir alanın hızlı gelişimi ile yakından ilişkiliydi.

25. soru
Watson ve Crick, DNA'nın yapısını incelemelerinden, olası DNA replikasyonu, kodlama yeteneği ve mutasyon mekanizması hakkında ne çıkardılar?
Cevap:
Watson ve Crick'in DNA replikasyonu üzerine çıkarımı: Bir sarmaldaki DNA zincirinin her birinin, DNA replikasyonu sırasında kalıp görevi gördüğü ve ebeveyn zincirini tamamlayıcı olan yeni yavru DNA moleküllerinin oluşumuna yol açtığı sonucuna varmışlardır (yani, Yarı-koruyucu yöntem. replikasyon) Kodlama kabiliyetine ilişkin çıkarım: Transkripsiyon sırasında, DNA zincirindeki genetik bilgi, tamamlayıcı bazlar olarak mRNA'ya kodlanır (RNA'da timin yerine urasil hariç) Mutasyona ilişkin çıkarım: DNA'nın nükleotid dizisindeki herhangi bir değişiklik, spesifik proteinin aminoasit dizisindeki karşılık gelen değişiklik, böylece genetik kodun geçerliliğini doğrular.

26. soru
Neden tRNA'ya adaptör molekül deniyor?
Cevap:
Bir hücrenin transfer RNA, (tRNA) molekülü, sitoplazma boyunca dağılmış amino asitleri toplayan ve ayrıca mRNA moleküllerinin spesifik kodlarını okuyan bir araç görevi görür. Bu nedenle adaptör molekül olarak adlandırılır. Bu terim Francis Crick tarafından ileri sürülmüştür.

27. soru
RNA ve DNA arasındaki üç yapısal fark nedir?
Cevap:
DNA:

  1. Şeker deoksiriboz şekerdir.
  2. Çift iplikli yapı.
  3. Azot bazları Adenin, Guanin, Sitozin ve Timindir.
  1. Şeker riboz şekeridir.
  2. Tek sarmallı molekül.
  3. Azot bazları Adenin, Guanin, Sitozin ve Urasil'dir.

28. soru
Aşağıdaki kodonları tanımak için gereken antikodonu adlandırın:
AAU, CGA, UAU ve GCA.
Cevap:
UUA, GCU, AUA ve CGU.

Soru 29.
(a) Aşağıda verilen şekli belirleyiniz
(b) Yapıyı çoğaltma çatalı olarak yeniden çizin ve parçaları etiketleyin
(c) Bu replikasyon için enerji kaynağını yazın ve bu süreçte yer alan enzimi adlandırın.
(d) İki şablon ipliğin polaritesine bağlı olarak protein sentezindeki farklılıklardan bahsedin.
Cevap:
(a) Çoğaltma çatalı
(B)

(c) Deoksi nükleotit, trifosfat replikasyon için bir enerji kaynağı görevi görür. DNA polimeraz replikasyon için kullanılır
(d) Protein sentezi için mRNA temas bilgileri, polaritesi 5' → 3' olan DNA zincirinden geliştirilecektir.

Soru 30.
Bir transkripsiyon birimindeki kodlama dizisi aşağıdaki gibi yazılırsa:
5' TGCATGCATGCATGCATGCATGCATGC 3'
mRNA dizisini yazın.
Cevap:
mRNA dizisi 3'ACGUACGUACGUUCGUACGUACGUACG5'

31. soru.
Protein sentezinin iki aşamalı süreci nasıl avantajlıdır?
Cevap:
Ökaryotik genlerin bölünmüş gen özelliği, prokaryotlarda neredeyse tamamen yoktur. Başlangıçta her ekson, belirli bir işleve sahip tek bir polipeptit zinciri için kodlanmış olabilir. Ekson düzenlemesi ve intron çıkarılması esnek olduğundan, bu polipeptit alt birimlerini kodlayan ekson, yeni genler oluşturmak için çeşitli şekillerde birleşen alanlar olarak işlev görür. Tek genler, hayvanlarda hem protein hem de fonksiyonel çeşitliliğin üretilmesinde önemli bir rol oynadığı bilinen bir mekanizma olan alternatif ekleme paternleri yoluyla eksonlarını birkaç farklı şekilde düzenleyerek farklı fonksiyonel proteinler üretebilir. İntronlar, ökaryotik genin evriminden önce veya sonra ortaya çıkmış olurdu.

İntronlar geç ortaya çıktıysa ökaryotik gene nasıl girdiler? İntronlar, kendilerini mobil transpozon benzeri elementler (organizmalar arasında gen transferine aracılık eden – Horizontal Gen Transfer – HGT) gibi davranan belirli 'hedef bölgelerin' dışında ve aynı zamanda bunlara ekleyebilen hareketli DNA dizileridir. HGT, prokaryotik hücrelerin soyları arasında veya prokaryotik hücrelerden ökaryotik hücrelere ve ökaryotik hücreler arasında meydana gelir. HGT'nin artık Dünya'daki yaşamın evriminde önemli bir rol oynadığı varsayılıyor.

32. soru.
Neden Hershey ve Chase sadece radyoaktif olarak işaretlenmiş fosfor ve kükürt kullandı? Radyoaktif olarak işaretlenmiş karbon ve nitrojen kullansalar aynı sonucu alırlar mıydı?
Cevap:
Genellikle proteinler kükürt içerir ancak fosfor içermez ve nükleik asit (DNA) , fosfor içerir ancak kükürt içermez. Bu nedenle Hershey – Chase, kültür ortamında viral protein ve nükleik asidin ayrı izini tutmak için kükürt (35 S) ve fosforun (32 P) radyoaktif izotoplarını kullandı. Radyoaktif karbon ve nitrojen kullanılırsa bu moleküller hem DNA'da hem de proteinlerde bulunduğundan beklenen sonuca ulaşılamaz.

33. soru
Nükleozom oluşumunu açıklayınız.
Cevap:
Komberg, nükleozom için, dört histon proteini H2A, H2B, H3 ve H4'ün 2 molekülünün, histon oktamer adı verilen sekiz molekülden oluşan bir birim oluşturacak şekilde düzenlendiği bir model önerdi.

Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir. Histon oktamerleri yakın temas halindedir ve DNA, nükleozomun dışına sarılmıştır.

Soru 34.
RNA'nın ilk genetik materyal olduğu tespit edilmiştir. Gerekçe vererek gerekçelendirin.
Cevap:
1980'lerin başında üç moleküler biyolog (Leslie Orgel, Francis Brick ve Carl Woese) bağımsız olarak, yaşamın evriminin ilk aşaması olarak 'RNA dünyasını' önerdiler; bu aşama, RNA'nın hayatta kalma ve replikasyon için gerekli tüm molekülleri katalize ettiği bir aşamaydı. İlk olarak 1986'da Walter Gilbert tarafından kullanılan 'RNA dünyası' terimi, RNA'nın dünyadaki ilk genetik olduğunu varsayıyor. Artık temel yaşam süreçlerinin (metabolizma, translasyon ve ekleme vb.) RNA etrafında geliştiğini öne sürmek için yeterli kanıt var. RNA, hem genetik materyal hem de katalizör görevi görme yeteneğine sahiptir. Canlı sistemlerde RNA tarafından katalize edilen birkaç biyokimyasal reaksiyon vardır. Bu katalitik RNA, ribozim olarak bilinir. Ancak, bir katalizör olan RNA reaktifti ve dolayısıyla kararsızdı.

Bu, belirli kimyasal modifikasyonlarla daha kararlı bir DNA formunun evrimine yol açtı. DNA, tamamlayıcı zincire sahip çift sarmallı bir molekül olduğundan, bir onarım süreci geliştirerek değişikliklere direnmiştir. Bazı RNA molekülleri, DNA'ya bağlanarak gen düzenleyicileri olarak işlev görür ve gen ekspresyonunu etkiler. Bazı virüsler genetik materyal olarak RNA kullanır. Andrew Fire ve Craig Mellow (2006 Nobel Ödülü sahipleri), RNA'nın yaşam kimyasında aktif bir bileşen olduğu görüşündeydiler.

Samacheer Kalvi 12. Biyo Zooloji Moleküler Genetik Ek Sorular ve Cevaplar

Soru 1.
'Gen' terimi ___________ tarafından icat edildi
Cevap:
Wilhelm Johannsen

Soru 2.
Sonunda kimin deneyi, DNA'nın genetik materyal olduğuna dair ikna edici kanıtlar sağladı?
(a) Griffith deneyi
(b) Avery, Macleod ve McCarty'nin deneyi
(c) Hershey-Chase deneyi
(d) Urey-Miller'in deneyi
Cevap:
(c) Hershey-Chase deneyi

Soru 3.
Hershey – Chase deneyinde, T 2 fazının DNA'sı ___________ kullanılarak radyoaktif hale getirildi.
(a) 32P
(b) 32 S
(c) 35P
(d) 32 S
Cevap:
(a) 32P

Soru 4.
Bir nükleosit ____________
(a) Şeker ve Fosfat
(b) Azot bazı ve Fosfat
(c) Şeker ve Azot bazı
(d) Şeker, Fosfat ve Azotlu baz
Cevap:
(c) Şeker ve Azot bazı

Soru 5.
Yanlış ifadeyi tanımlayın
(a) baz, H+ iyonu kabul eden bir maddedir.
(b) Hem DNA hem de RNA dört baza sahiptir.
(c) Pürinler tek karbon-azot halkasına sahiptir
(d) Timin DNA için benzersizdir
Cevap:
(c) Pürinler tek karbon-azot halkasına sahiptir

Soru 6.
Watson ve Crick, f __________ X-ışını kırınım analizine dayanan çift sarmal DNA modelini önerdiler.
(a) Erwin Chargaff
(b) Meselson ve Stahl
(c) Wilkins ve Franklin
(d) Griffith
Cevap:
(c) Wilkins ve Franklin

7. soru
'RNA dünyası' terimi ilk olarak ___________ tarafından kullanılmıştır.
Cevap:
Walter Gilbert

Soru 8.
DNA'da ardışık iki baz çifti arasındaki mesafe ____________
(a) 0.34 nm
(b) 3.4 nm
(c) 0.034 nm
(d) 34 nm
Cevap:
(a) 0.34 nm

Soru 9.
E. coli DNA'sının uzunluğu 1,36 mm ise baz çifti sayısı ____________
(a) 0.36 × 106 m
(b) 4 × 106 m
(c) 0.34 × 10 -9 nm
(d) 4 × 10 -9 m
Cevap:
(b) 4 × 106 m

Soru 10.
Ökaryotik kromozomun organizasyonunda uygun diziyi belirleyin.
(a) Nükleozom – Solenoid – Kromatit
(b) Kromatid – Nükleozom – Solenoidi
(c) Solenoid – kromatin – DNA
(d) Nükleozom – solenoid – genoforu
Cevap:
(a) Nükleozom – Solenoid – Kromatit

Soru 11.
İddia (A) : Prokaryotlarda genofor fark edilir.
Sebep (R) : Bakteriler, kromatin organizasyonu olmayan dairesel DNA'ya sahiptir.
(a) Hem A hem de R doğrudur
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(c) R, A'yı açıklar

Soru 12.
İddia (A): Heterokromatin transkripsiyonel olarak aktiftir.
Sebep (R): Koyu lekeli, sıkıca paketlenmiş kromatin.
(a) Hem A hem de R doğrudur
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(d) A yanlış, R doğru

Soru 13.
İddia (A) : Yarı-muhafazakar model Hershey ve Chase tarafından önerildi.
Sebep (R) : Kız DNA'sı sadece yeni iplikler içerir.
(a) Hem A hem de R yanlış
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(a) Hem A hem de R yanlış

Soru 14.
Komberg enzimi _____ olarak adlandırılır.
Cevap:
DNA polimeraz I

Soru 15.
DNA replikasyonu hücre döngüsünün __________ fazında gerçekleşir.
(NS
(b) S
(c)1
(d)2
Cevap:
(b) S

Soru 16.
Yarı muhafazakar çoğaltma modeli __________ tarafından kanıtlanmıştır.
(a) Hershey ve Chase
(b) Griffith
(c) Meselson ve Stahl
(d) Macleod ve McCarty
Cevap:
(c) Meselson ve Stahl

Soru 17.
Bir ökaryotik hücrede kaç çeşit DNA polimeraz bulunur?
(a) iki
(b) üç
(c) dört
(d) beş
Cevap:
(d) Beş

Soru 18.
Yanlış ifadeyi tanımlayın
(a) Replikasyon, DNA'nın ori – bölgesinde meydana gelir
(b) Deoksi nükleotid trifosfat bir substrat görevi görür
(c) DNA zincirinin çözülmesi topoizomeraz tarafından gerçekleştirilir
(d) DNA polimeraz 3-OH'de polimerizasyonu katalize eder
Cevap:
(c) DNA zincirinin çözülmesi topoizomeraz tarafından gerçekleştirilir

Soru 19.
Süreksiz olarak sentezlenen gecikmeli iplik parçalarına ________ denir.
Cevap:
Okazaki parçaları

Soru 20.
Retrovirüsler, genetik materyal olarak ________ sahiptir.
Cevap:
RNA

Soru 21.
Hangisi transkripsiyon ünitesinin bir parçası DEĞİLDİR?
(a) Destekleyici
(b) Operatör
(c) Yapısal gen
(d) Sonlandırıcı
Cevap:
(b) Operatör

22. soru
Goldberg – Hogness ökaryot kutusu, ________ prokaryota eşdeğerdir.
Cevap:
Pribnow kutusu

23. soru
Okazaki fragmanları, DNA replikasyonu sırasında ________ enzimi ile birleştirilir.
Cevap:
DNA ligazı

Soru 24.

Cevap:
(a) A – iv, B – i, C – ii, D – iii

25. soru
Prokaryotların RNA polimerazı, polimerizasyonu başlatmak için faktöre bağlanır.
(a) ro
(b) teta
(c) sigma
(d) psi
Cevap:
(c) sigma

26. soru

(a) Sınırlama
(b) Kuyruk
(c) Ekleme
(d) Transkripsiyon
Cevap:
(c) Ekleme

27. soru
Prokaryotlarda aşağıdaki özelliklerden hangisi yoktur?
(a) Prokaryotlar üç ana RNA tipine sahiptir
(b) Yapısal genler polisistroniktir
(c) Transkripsiyonun başlama süreci 'P' faktörünü gerektirir
(d) Bölünmüş gen özelliği
Cevap:
(d) Bölünmüş gen özelliği

28. soru
Aşağıdaki dizilerden hangisi tam olarak çevrilmiştir?
(i) AGA, UUU, UGU, AGÜ, UAG
(ii) AĞUSTOS, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AĞUSTOS,AAU,AAC,UAU,UAG
(a) ben ve ii
(b) sadece ii
(c) ben ve iii
(d) ii ve iv
Cevap:
(d) ii ve iv

Soru 29.
mRNA'nın kapatılması __________ kullanılarak gerçekleşir
(a) Poli A kalıntıları
(b) Metil guanozin trifosfat
(c) Deoksi ribonükleotit trifosfat
(d) Ribonükleotid trifosfat
Cevap:
(b) Metil guanozin trifosfat

Soru 30.
Bir yönü genetik kodun bir özelliği değil mi?
(a) Spesifik
(b) Dejenere
(c) Evrensel
(d) belirsiz
Cevap:
(d) belirsiz

31. soru.
Üçlü kodonlardan hangisi prolin kodu değildir?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) sadece ben
(b) ii ve iv
(c) sadece iii
(d) yukarıdakilerin tümü
Cevap:
(b) ii ve iv

32. soru.
Bölünmüş genlerde bulunan kodlama dizilerine denir.
(a) Operonlar
(b) İntronlar
(c) Eksonlar
(d) Sistron
Cevap:
(c) Eksonlar

33. soru
Aşağıdaki mRNA'lardan hangisi translasyondan sonra 6 aminoasit verir?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AUG UAC CAU UGC UGA UGC AGG AGC CCG
Cevap:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Soru 34.
Prokaryotlarda RNA polimeraz ile ilişkili transkripsiyon sonlandırma faktörü
(a) θ
(b) σ
(c) ρ
(d) ∑
Cevap:
(c) ρ

35. soru
Bir DNA çift sarmalında, guanin %30 ise, timinin yüzdesi ne olur?
(a) %100
(b) %20
(c) %10
(d) %70
Cevap:
(b) %20

36. soru
Tirozin için kodlayan üçlü çiftleri tanımlayın
(a) UUU,UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Cevap:
(b) UAU, UAU

37. soru.

Cevap:
A – ii B – i C – iv D – iii

Soru 38.
AUG kodu __________ içindir
(a) Arginin
(b) Tirozin
(c) Triptofan
(d) Metionin
Cevap:
(d) Metionin

Soru 39.
DNA'nın kodlama zincirindeki bazların dizisi G A G T A G C A G G C'dir, bu durumda birincil transkriptteki kodonların dizisi şöyledir:
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Cevap:
(b) C U C A A U C G U C C G

Soru 40.
Ökaryotun promotör bölgesi __________
(a) TATAA
(b) AĞUSTOS
(c) UUUGA
(d) AAAAU
Cevap:
(a) TATAA

41. soru
Aşağıdakileri eşleştirin:
(A) AĞUSTOS – (i) Tirozin
(B) UGA – (ii) Glisin
(C) UUU – (iii) Metionin
(D) GGG – (iv) Fenilalanin
(a) A – iii B – i C – iv D – ii
(b) A – iii B – ii C – i D – iv
(c) A – iv B – i C – iii D – ii
(d) A – ii B – i C – iv D – iii
Cevap:
(d) A – ii B – i C – iv D – iii

42. soru.
__________ kodon sayısı, sistin kodları.
Cevap:
2

43. soru.
Orak hücre anemisinde, β – globin geninin __________ kodonu değiştirilir.
(a) Sekizinci
(b) Yedinci
(c) Altıncı
(d) Dokuzuncu
Cevap:
(c) Altıncı

44. soru
Yanlış ifadeyi seçin.
(a) tRNA bir adaptör molekül gibi davranır
(b) Stop kodonlarında tRNA bulunmaz
(c) Aminoasidin eklenmesi tRNA'nın hidrolizine yol açar
(d) tRNA'nın dört ana döngüsü vardır
Cevap:
(c) Aminoasidin eklenmesi tRNA'nın hidrolizine yol açar

45. soru
Aşağıdaki antibiyotiklerden hangisi tRNA ile mRNA arasındaki etkileşimi inhibe eder?
(a) Neomisin
(b) Streptomisin
(c) Tetrasiklin
(d) Kloramfenikol
Cevap:
(a) Neomisin

47. soru.
İlgili işleve sahip gen kümesine _________ denir.
(a) Sistron
(b) Operon
(c) Muton
(d) Keşif
Cevap:
(b) Operon

48. soru.
Lac operonunun baskılayıcı proteini, operonun __________'sına bağlanır.
(a) Destekleyici bölge
(b) Operatör bölgesi
(c) sonlandırıcı bölge
(d) indükleyici bölge
Cevap:
(b) Operatör bölgesi

49. soru
__________ için Lac Z gen kodları
(a) Geçirgenlik
(b) transasetilaz
(c) β-galaktosidaz
(d) Aminoasil transferaz
Cevap:
(c) β-galaktosidaz

Soru 50.
Lac operon modeli __________ tarafından önerildi
Cevap:
Yakup ve Monod

51. soru
İnsan genomundaki yaklaşık baz çifti sayısı __________
Cevap:
3 × 10 9 bp

52. soru
Otomatik DNA dizileri tarafından geliştirilmiştir.
Cevap:
Frederick Sanger

53. soru
Hangi kromozomun gen yoğunluğu daha yüksektir?
(a) Kromozom 20
(b) Kromozom 19
(c) Kromozom 13
(d) Kromozom Y
Cevap:
(b) Kromozom 19

54. soru
Y kromozomunda bulunan gen sayısı __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Cevap:
(d) 231

55. soru
E.Coli'nin lac operonunda kaç tane yapısal gen bulunur?
(a) 4
(b) 3
(c) 2
(d) 1
Cevap:
(b) 3

56. soru
DNA parmak izi tekniği geliştirildi
(a) Yakup ve Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Cevap:
(b) Alec Jeffreys

57. soru
DNA parmak izinde, DNA parçalarının ayrılması __________ ile yapılır.
(a) Santrifüjleme
(b) Elektroforez
(c) X-ışını kırınımı
(d) denatürasyon
Cevap:
(b) Elektroforez

58. soru
SNP'nin kısaltması
(a) Tek nükleotid Polimorfizmi
(b) Tek Nükleozit Polipeptidi
(c) Tek nükleotid Polimorfizmi
(d) Tek nükleotid polimer
Cevap:
(a) Tek nükleotid Polimorfizmi

Soru 59.
Çeviri yapılmayan spesifik mRNA dizileri __________
Cevap:
Çevrilmemiş Bölgeler (UTR)

60. soru.
Kodlamayan veya araya giren DNA dizisine __________ denir.

Soru 61.
_______ İntron, DNA'nın monomeridir.
Cevap:
nükleotid

Soru 62.
Aşağıdakilerden hangisi yanlış eşleştirilmiştir?
(a) Transkripsiyon – DNA'dan RNA'ya bilgi kopyalama
(b) Çeviri – mRNA'dan proteine ​​bilgi çözme
(c) Replikasyon – DNA kopyalarının yapılması
(d) Eksonların intronlarla birleştirilmesi –
Cevap:
(d) Eksonların intronlarla birleştirilmesi –

Soru 1.
Bir gen – Bir enzim hipotezini kim önerdi? Tanımla.
Cevap:
George Beadle ve Edward Tatum, bir genin bir enzimin üretimini kontrol ettiğini belirten Bir gen – Bir enzim hipotezi önerdiler.

Soru 2.
Nükleosidi nükleotitten ayırt edin.
Cevap:

  1. Nükleozit: Nükleozit alt birimi, bir pentoz şeker molekülüne bağlı azotlu bazlardan oluşur.
  2. nükleotid: Nükleotid alt birimi, azotlu bazlardan, bir pentoz şekeri ve bir fosfat grubundan oluşur.

Soru 3.
DNA ve RNA arasındaki temel farkları belirtin.
Cevap:
DNA:

  1. DNA, deoksiriboz şekerinden yapılmıştır.
  2. DNA'nın azotlu bazları Adenin, Guanin, Sitozin ve Timin'dir.
  1. RNA riboz şekerinden yapılır.
  2. RNA'nın azotlu bazları Adenin, Guanin, Sitozin ve Urasil'dir.

Soru 4.
RNA'nın azotlu bazlarına dikkat edin.
Cevap:
Adenin, Guanin, Sitozin ve Urasil.

Soru 5.
DNA ve RNA'yı asidik moleküller yapan nedir?
Cevap:
Fosfat fonksiyonel grubu (PO4) DNA ve RNA'ya fizyolojik pH'ta bir asidin özelliğini verir, dolayısıyla nükleik asit adını verir.

Soru 6.
Hangi tür bağ oluşur

  1. pürin ve pirimidin bazı arasında?
  2. pentoz şekeri ve bitişik nükleotit arasında?
  1. Purin ve pirimidin bazları hidrojen bağları ile bağlanır.
  2. Pentoz şekeri, bitişik nükleotide fosfodiester bağları ile bağlanır.

7. soru
DNA, canlı organizmaların çoğu için RNA değil, genetik materyal görevi görür. İfadeyi desteklemek için nedenler belirtin.
Cevap:

  1. RNA reaktifti ve bu nedenle oldukça kararsızdı.
  2. Bazı RNA molekülleri, DNA'ya bağlanarak gen düzenleyicileri gibi davranır ve gen ekspresyonunu etkiler.
  3. RNA'nın urasili, DNA'nın timinden daha az kararlıdır.

Soru 8.
Genetik materyali RNA olan iki virüsü adlandırın.
Cevap:

Soru 9.
Bir molekülün genetik materyal olarak hareket etmesi için sahip olması gereken özellikler nelerdir?
Cevap:

  1. Kendini çoğaltma
  2. Bilgi depolama
  3. istikrar
  4. Mutasyon yoluyla varyasyon

Soru 10.
DNA sarmalının bir tam dönüşünde kaç baz çifti bulunur? Ardışık iki baz çifti arasındaki mesafe nedir?
Cevap:
İki bitişik baz çifti arasında 0.34 x 109m mesafe ile her dönüşte on baz çifti vardır.

Soru 11.
Genofor nedir?
Cevap:
E. coli gibi prokaryotlarda tanımlanmış bir çekirdeğe sahip olmasalar da, DNA hücrenin her tarafına dağılmamıştır. DNA (negatif yüklü), nükleoid adı verilen bir bölgede bazı proteinlerle (pozitif yükleri olan) tutulur. Bir nükleoid olarak DNA, protein tarafından tutulan büyük halkalar halinde düzenlenir. Prokaryotların DNA'sı neredeyse daireseldir ve kromatin organizasyonundan yoksundur, dolayısıyla genofor olarak adlandırılır.

Soru 12.
Nükleozom nedir? Tipik bir nükleozomda kaç baz çifti vardır?
Cevap:
Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir.

Soru 13.
NHC'yi genişletin ve tanımlayın
Cevap:

  1. NHC : Histon olmayan Kromozomal protein.
  2. Ökaryotlarda, histon proteinlerinin yanı sıra, kromatinin daha yüksek düzeyde paketlenmesi için ek protein setlerine ihtiyaç vardır ve bunlar histon olmayan kromozomal proteinler olarak adlandırılır.

Soru 14.
Heterokromatin ve Ökromatin arasında ayrım yapın.
Cevap:
heterokromatin:

  1. Kromatinin gevşek bir şekilde paketlendiği ve ışığı lekelediği çekirdek bölgesine Heterokromatin denir.
  2. Transkripsiyonel olarak etkin değil.
  1. Kromatinin sıkıca paketlendiği ve lekelerin koyu olduğu çekirdek bölgesine Ökromatin denir.
  2. Transkripsiyonel olarak aktif.

Soru 15.
Yaygın olarak kabul edilen DNA replikasyonu modeli hangisidir? Kim kanıtladı?
Cevap:
Yarı muhafazakar çoğaltma modeli. 1958 yılında Meselson ve Stahl tarafından kanıtlanmıştır.

Soru 16.
Adıyla anılan kimyasal maddeyi adlandırın

  1. DNA polimeraz I, Komberg enzimi olarak da bilinir.
  2. Polinükleotid fosforilaz, Ochoa enzimi olarak da bilinir.

Soru 17.
Çeşitli prokaryotik DNA polimeraz türlerini adlandırın. Çoğaltma sürecindeki rollerini belirtin.
Cevap:

  1. DNA Polimeraz I DNA onarım mekanizmasına dahil olur
  2. DNA Polimeraz II DNA onarım mekanizmasına dahil olur
  3. DNA Polimeraz III DNA replikasyonunda yer alır

Soru 18.
Deoksi nükleotid trifosfatın replikasyondaki işlevi nedir?
Cevap:
Deoksi nükleotit trifosfat, substrat görevi görür ve ayrıca polimerizasyon reaksiyonu için enerji sağlar.

Soru 19.
Aşağıda verilen bazı ökaryotik replikasyon olaylarıdır. İşlemde yer alan enzimleri adlandırın.

  1. DNA'nın çözülmesi
  2. Okazaki parçalarının birleştirilmesi
  3. Yeni zincire nükleotidlerin eklenmesi
  4. Onarımın düzeltilmesi

Soru 20.
Öndeki ipliği gecikmeli iplikten ayırt edin
Cevap:
önde gelen iplikçik:

Soru 21.
Okazaki parçaları nelerdir?
Cevap:
Gecikmeli ipliğin süreksiz olarak sentezlenen fragmanlarına, DNA ligaz enzimi ile birleştirilen Okazaki fragmanları denir.

22. soru
Çoğaltma çatalı nedir?
Cevap:
Replikasyonun başlangıç ​​noktasında, helikazlar ve topoizomerazlar (DNA giraz) çözülür ve iplikleri birbirinden ayırır, replikasyon çatalı adı verilen Y-şekilli bir yapı oluşturur. Her kaynakta iki çoğaltma çatalı vardır.

23. soru
DNA polimeraz dışında, ökaryotik hücrenin DNA replikasyonunda yer alan diğer dört enzimi adlandırın.
Cevap:
DNA ligaz, Topoizomeraz (DNA giraz), Helikaz ve Nükleaz.

Soru 24.
Merkezi dogmayı kim önerdi? Konseptini yazınız.
Cevap:
Francis Crick, moleküler biyolojide genetik bilginin aşağıdaki gibi aktığını belirten Merkezi dogmayı önerdi:

25. soru
Transkripsiyonu tanımlayın ve bu süreçte yer alan enzimi adlandırın.
Cevap:
Genetik bilginin bir DNA dizisinden RNA'ya kopyalanması işlemine transkripsiyon denir. Bu işlem, DNA'ya bağımlı RNA polimeraz varlığında gerçekleşir.

26. soru
TATA kutusu nedir? İşlevini belirtin.
Cevap:
Ökaryotlarda, promotör, TATA kutusu veya Goldberg-Hogness kutusu olarak adlandırılan zengin AT bölgelerine sahiptir. RNA polimeraz için bir bağlanma yeri görevi görür.

27. soru
Ökaryotların yapısal geni prokaryotlardan farklıdır. Nasıl?
Cevap:
Ökaryotlarda yapısal gen sadece bir proteini kodlayan monosistronik iken prokaryotlarda yapısal gen birçok proteini kodlayan polisistroniktir.

28. soru
Prokaryotik RNA polimerazın iki ana bileşeni nelerdir? Nasıl davranırlar?
Cevap:
Bakteriyel (prokaryotik) RNA polimeraz, çekirdek enzim ve sigma alt birimi olmak üzere iki ana bileşenden oluşur.Çekirdek enzim (β1, β ve α), RNA sentezinden ” sorumludur, oysa promotörün tanınmasından bir sigma alt birimi sorumludur.

Soru 29.
Eksonlar ve intronlar arasında ayrım yapın.
Cevap:

  1. Eksonlar: Bir ökaryotik genin eksprese edilmiş dizileri (Kodlama dizileri)
  2. İntronlar: Bir ökaryotik genin araya giren dizileri (kodlayıcı olmayan diziler)

Soru 30.
Eklemeyi tanımlayın.
Cevap:
İntronları hnRNA'dan çıkarma işlemine ekleme denir.

31. soru.
Kapatma ve kuyruklama nedir?
Cevap:
Alışılmadık bir nükleotidin kapatılmasında, hnRNA'nın 5' ucuna metil guanozin trifosfat eklenirken, kuyrukta 3' ucuna adenilat kalıntıları (200-300) (Poli A) eklenir.

32. soru.
Çift sarmallı bir DNA'da %20 sitozin varsa, DNA'daki adenin yüzdesini hesaplayın.
Cevap:
Sitdsine = 20, dolayısıyla Guanin = 20
ChargafFs kuralına göre (A+T) = (G+C) =100
Timin + Adenin Yüzdesi = 20 + 20 = 100
(T + A) = (20 + 20) =100
(T + A)=100-(20 + 20)
T +A = 100 – 40
T + A = 60
Bu nedenle Adenin yüzdesi 60/2 = %30 olacaktır.

33. soru
AUG'nin ikili işlevlerinden bahsedin.
Cevap:
AUG'nin çift işlevi vardır. Bir başlatıcı kodon görevi görür ve ayrıca metiyonin amino asidini kodlar.

Soru 34.
Translasyonun sonlandırılmasında kaç kodon yer alır. Onlara isim verin.
Cevap:
Üç kodon, çeviri sürecini sonlandırır. Bunlar UAA, UAG ve UGA'dır.

35. soru
Kodonun yozlaşması – yorumu.
Cevap:
Dejenere bir kod, birden fazla üçlü kodonun belirli bir amino asidi kodlayabileceği anlamına gelir. Örneğin, valin için kodonlar GUU, GUC, GUA ve GUG kodu.

36. soru
Genetik kodun evrenselliğine ilişkin istisnai kategorilere dikkat edin.
Cevap:
Genetik kodun evrensel doğasının istisnaları, prokaryotik mitokondriyal ve kloroplast genomlarında fark edilir.

37. soru.
Anlamsız kodonlar nelerdir?
Cevap:
UGA, UAA ve UAG, çeviriyi sonlandıran anlamsız kodonlardır.

Soru 38.
Kodlayan üçlü kodonları adlandırın

Soru 39.
Neden hnRNA'nın ekleme geçirmesi gerekiyor?
Cevap:
hnRNA hem kodlayıcı dizileri (eksonlar) hem de kodlamayan dizileri (intronlar) içerdiğinden, intronları çıkarmak için uçbirleştirmeye tabi tutulması gerekir.

Soru 40.
Aşağıdaki kodonların çeviri sürecindeki rolünü belirtiniz

41. soru
Aşağıda verilen mRNA dizisidir. Translasyonundan sonra oluşan aminoasit dizisinden bahsedin.
Cevap:
3'AUGAAGAUGGGUAA5'
Metionin – Lizin – Aspartik asit – Glisin

42. soru.
Valine kodlayan dört kodonu adlandırın.
Cevap:
GUU, GUC, GUA ve GUG.

43. soru.
DNA zincirlerinden birindeki baz dizisi TAGC ATGAT'dir. Tamamlayıcı dizisindeki baz dizisinden bahsedin.
Cevap:
Tamamlayıcı iplikte ATCGTACTA vardır.

44. soru
Neden t-RNA adaptör molekül olarak adlandırılıyor?
Cevap:
Bir hücrenin transfer RNA (tRNA) molekülü, sitoplazma boyunca dağılmış amino asitleri toplayan ve ayrıca mRNA moleküllerinin spesifik kodlarını okuyan bir araç görevi görür. Bu nedenle adaptör molekül olarak adlandırılır.

45. soru
tRNA'nın yüklenmesi ile ne demek istiyorsun? Bu süreçte yer alan enzimi adlandırın.
Cevap:
Amino asidin tRNA'ya eklenmesi işlemi, aminoasilasyon veya yükleme olarak bilinir ve elde edilen ürüne aminoasil-tRNA (yüklü tRNA) denir. Aminoasilasyon, bir aminoasil – tRNA sentetaz enzimi tarafından katalize edilir.

46. ​​soru.
UTR'ler nelerdir?
Cevap:
mRNA'nın ayrıca çevrilmemiş ve Çevrilmemiş Bölgeler (UTR) olarak adlandırılan bazı ek dizileri vardır. UTR'ler hem 5' ucunda (başlangıç ​​kodonundan önce) hem de 3' ucunda (durdurma kodonundan sonra) bulunur.

47. soru.
S – D dizisi nedir?
Cevap:
Prokaryotların mRNA'sının 5' ucu, mRNA'nın ilk AUG başlangıç ​​kodonundan önce gelen özel bir diziye sahiptir. Bu ribozom bağlanma bölgesi Shine – Dalgamo dizisi veya S-D dizisi olarak adlandırılır. Bu diziler, başlatmayı kolaylaştıran küçük ribozomal alt birimin 16Sr RNA'sının bir bölgesi ile baz çiftleri oluşturur.

48. soru.
Çeviri birimini tanımlayın.
Cevap:
mRNA'daki bir çeviri birimi, 5' ucunda başlangıç ​​kodonu ve 3' ucunda durdurma kodonu ve polipeptit kodlarıyla çevrili RNA dizisidir.

49. soru
Bakteri translasyonunda tetrasiklin ve streptomisinin inhibitör rolünden bahsedin.
Cevap:
Tetrasiklin, aminoasil tRNA ve mRNA arasındaki bağlanmayı engeller. Streptomisin, translasyonun başlamasını engeller ve yanlış okumaya neden olur.

Soru 50.
Gen ifadesi hangi aşamada düzenlenir?
Cevap:
Gen ifadesi, transkripsiyonel veya translasyonel seviyelerde kontrol edilebilir veya düzenlenebilir.

51. soru
operon nedir? Örnek ver.
Cevap:
İlgili işlevlere sahip gen kümesine operon denir.
Örn: E.coli'de lac operon.

52. soru
E.coli'nin lac operonunu dikkate alarak aşağıdaki genlerin ürünlerini adlandırın.

  1. gen – baskılayıcı protein
  2. lac Z geni – fS-galaktosidaz
  3. Lac Y geni – Geçirgenlik
  4. lac a gen – transasetilaz

54. soru
sahip olan insan kromozomunu adlandırın.

  1. Kromozom 1 maksimum sayıda gen içerir (2968 gen)
  2. Y kromozomu en az gene sahiptir (231 gen)

55. soru
SNP'ler nelerdir? Kullanımlarından bahsedin.
Cevap:
SNP'ler : Tek nükleotid polimorfizmi. Hastalıkla ilişkili diziler için kromozomal konumların bulunmasına ve insanlık tarihinin izlenmesine yardımcı olur.

56. soru
DNA parmak izinin kullanılabileceği dört alandan bahsedin.
Cevap:

  1. Adli analiz
  2. soy analizi
  3. Yaban hayatının korunması
  4. antropolojik çalışmalar

57. soru
Nükleik asitleri şeker moleküllerine göre sınıflandırır.
Cevap:
Pentoz şekerinin türüne bağlı olarak iki tür nükleik asit vardır. Deoksiriboz şeker içerenlere Deoksiribo Nükleik Asit (DNA), riboz şeker içerenlere Ribonükleik Asit (RNA) denir. Bu iki şeker arasındaki tek fark, deoksiribozda bir oksijen atomunun eksik olmasıdır.

58. soru
Hem pürinler hem de pirimidinler azot bazlarıdır, ancak farklıdırlar. Nasıl?
Cevap:
Hem pürinler hem de pirimidinler azot bazlarıdır. Pürin bazları Adenin ve Guanin çift karbonlu nitrojen halkasına sahipken, sitozin ve timin bazları tek karbonlu nitrojen halkasına sahiptir.

Soru 59.
5' DNA'sı 3'ünden ne kadar farklıdır?
Cevap:
DNA'nın 5', fosfat (P04V) fonksiyonel grubunun eklendiği şekerdeki karbonu belirtir. DNA'nın 3', bir hidroksil (OH) grubunun eklendiği şekerdeki karbonu belirtir.

60. soru.
Eyalet Chargaff kuralı.
Cevap:
Erwin Chargaff'a göre,

  1. Adenin, Timin ile iki hidrojen bağı ile eşleşir.
  2. Guanin, üç hidrojen bağı ile Sitozin ile eşleşir.

Soru 61.
Kimyasal olarak DNA, RNA'dan daha kararlıdır – Justify.
Cevap:
DNA'da tamamlayıcı olan iki iplik, ısıtılarak ayrılırsa (denatüre edilirse) uygun koşul sağlandığında bir araya gelebilir (renatürasyon). RNA'daki her nükleotitte bulunan diğer 2 OH grubu, RNA'yı sorumlu ve kolayca bozunabilir yapan reaktif bir gruptur. RNA'nın katalitik ve reaktif olduğu da bilinmektedir. Bu nedenle, DNA, RNA ile karşılaştırıldığında kimyasal olarak daha kararlı ve kimyasal olarak daha az reaktiftir. DNA'da urasil yerine timinin varlığı, DNA'ya ek stabilite sağlar.

Soru 62.
Yarı muhafazakar DNA replikasyonu modu hakkında basit bir şekilde yazın.
Cevap:
Yarı-koruyucu replikasyon 1953'te Watson ve Crick tarafından önerildi. Bu replikasyon mekanizması DNA modeline dayanmaktadır. DNA molekülünün iki polinükleotid zincirinin gevşeyip bir uçtan ayrılmaya başladığını öne sürdüler. Bu işlem sırasında kovalent hidrojen bağları kırılır. Ayrılan tek iplik daha sonra yeni bir ipliğin sentezi için şablon görevi görür. Daha sonra, her bir kız çift sarmal, ana molekülden bir şablon görevi gören bir polinükleotit zinciri taşır ve diğer zincir yeni sentezlenir ve ana sarmalın tamamlayıcısıdır.

Soru 63.
Basitleştirilmiş bir nükleozom diyagramı çizin ve etiketleyin.
Cevap:

64. soru.
astar nedir?
Cevap:
Bir primer, kısa bir RNA dizisidir. Yeni iplik oluşumunu başlatır. Primer, yeni bir iplik oluşturmak için deoksiribonükleotitlerin eklendiği ribonükleotid dizisinde 3'-OH ucu üretir.

65. soru.
Her iki DNA dizisi de transkripsiyon sırasında kopyalanmaz. Sebep ver.
Cevap:
DNA'nın her iki ipliği de iki nedenden dolayı transkripsiyon sırasında kopyalanmaz.

  1. Her iki iplik de bir şablon görevi görürse, farklı dizilere sahip RNA'yı kodlarlar. Bu da farklı amino asit dizilerine sahip proteinleri kodlayacaktır. Bu, iki farklı proteini kodlayan bir DNA parçası ile sonuçlanacak ve dolayısıyla genetik bilgi transfer makinesini karmaşıklaştıracaktır.
  2. Aynı anda iki RNA molekülü üretilseydi, birbirini tamamlayan çift sarmallı RNA oluşacaktı. Bu, RNA'nın proteinlere çevrilmesini önleyecektir.

Soru 66.
Bir şablon dizisi ve kodlama dizisi ile ne demek istiyorsunuz?
Cevap:
DNA'ya bağımlı RNA polimeraz, polimerizasyonu sadece bir yönde katalize eder, 3'→ 5' polaritesine sahip iplik, kalıp görevi görür ve kalıp iplik olarak adlandırılır. 5'→ 3' polaritesine sahip olan diğer iplik, RNA ile aynı diziye sahiptir (urasil yerine timin hariç) ve transkripsiyon sırasında yer değiştirir. Bu diziye kodlama dizisi denir.

67. soru.
Prokaryotlarda transkripsiyonun başlamasından ve sona ermesinden sorumlu olan faktörleri adlandırın.
Cevap:

  1. Sigma faktörü, transkripsiyonun başlatılmasından sorumludur.
  2. Rho faktörü, transkripsiyonun sonlandırılmasından sorumludur.

Soru 68.
Prokaryotların başlıca RNA türlerini adlandırın ve rollerinden bahsedin.
Cevap:
Prokaryotlarda üç ana RNA türü vardır: mRNA, tRNA ve rRNA. Bir hücrede bir proteini sentezlemek için her üç RNA'ya da ihtiyaç vardır. mRNA şablonu sağlar, tRNA amino asitleri getirir ve genetik kodu okur ve rRNA'lar yapısal ve katalitik rol oynar.
çeviri sırasında.

Soru 69.
Genetik kodu tanımlayın.
Cevap:
DNA molekülü boyunca baz çiftlerinin sırası, bir organizmanın proteinlerinde bulunan amino asitlerin türünü ve sırasını kontrol eder. Baz çiftlerinin bu özel düzenine genetik kod denir.

70. soru
Wobble hipotezini açıklayın.
Cevap:
Wobble Hipotezi Crick (1966) tarafından tRNA antikodonunun mRNA kodonunun tamamlayıcı olmayan bazıyla bile eşleşerek 5' ucunda yalpalama yeteneğine sahip olduğunu ileri sürmüştür. üçüncü baz tamamlayıcı olmayabilir.

Kodonun üçüncü tabanına yalpalama tabanı ve bu pozisyona yalpalama pozisyonu denir. Gerçek baz eşleşmesi yalnızca ilk iki konumda gerçekleşir. Wobbling hipotezinin önemi, polipeptit sentezi için gerekli tRNA'ların sayısını azaltması ve kod dejenerasyonunun etkisinin üstesinden gelmesidir.

71. soru
Ökaryotik ribozomun doğasını açıklar.
Cevap:
Ökaryotların (80 S) ribozomları daha büyüktür ve 60 S ve 40 S alt birimlerinden oluşur. 'S', Svedberg birimi (S) olarak ifade edilen sedimantasyon verimini belirtir. Ökaryotlardaki daha büyük alt birim, 23 S RNA ve 5Sr RNA molekülü ve 31 ribozomal proteinden oluşur. Daha küçük ökaryotik alt birim, 18Sr RNA bileşeninden ve yaklaşık 33 proteinden oluşur.

72. soru.
ORF'yi genişletin ve tanımlayın.
Cevap:
Bir başlangıç ​​kodonu ile başlayan ve bir proteine ​​çevrilebilen herhangi bir DNA veya RNA dizisi, Açık Okuma Çerçevesi (ORF) olarak bilinir.

Soru 73.
Prokaryotik çevirinin başlama kompleksinin bileşenleri nelerdir?
Cevap:
E. coli'de translasyonun başlatılması, ribozomun 30S alt birimlerinden, bir haberci RNA'dan ve yüklü N-formil metionin tRNA'dan (f met -1 RNA f met ), üç proteinli başlatma faktöründen oluşan bir başlatma kompleksinin oluşumu ile başlar. (IF 1, IF2, IF3), GTP (Guaniner Tri Fosfat) ve Mg 2+.

Soru 74.
Operonun bileşenlerini açıklar.
Cevap:
Operonun yapısı: Her operon, bir gen ekspresyonu ve düzenleme birimidir ve aşağıdakilerden oluşur:
bir veya daha fazla yapısal genin ve transkripsiyonel kontrol eden bitişik bir operatör genin
yapısal genin aktivitesi.

  1. Yapısal gen, hücrenin ihtiyaç duyduğu proteinler, rRNA ve tRNA'yı kodlar.
  2. Promotörler, RNA sentezini başlatan DNA'daki sinyal dizileridir. RNA polimeraz I, transkripsiyonun başlamasından önce promotöre bağlanır.
  3. Operatörler, promotörler ve yapısal genler arasında bulunur. Baskılayıcı protein, operonun operatör bölgesine bağlanır.

75. soru.
Hershey ve Chase deneyini açıklayın. Onların deneyi ne sonuca varıyor?
Cevap:
Alfred Hershey ve Martha Chase (1952), bakterileri enfekte eden bakteriyofajlar üzerinde deneyler yaptılar. Faj T2 Escherichia coli bakterisini enfekte eden bir virüstür. Bakterilere fajlar (virüs) eklendiğinde, dış yüzeye adsorbe olurlar, bazı materyaller bakteriye girer ve daha sonra her bakteri çok sayıda soy fajını serbest bırakmak için parçalanır. Hershey ve Chase, bakterilere girenin DNA mı yoksa protein mi olduğunu gözlemlemek istediler. Tüm nükleik asitler fosfor içerir ve kükürt içerir (sistein ve metionin amino asidinde). Hershey ve Chase, enfeksiyon sürecinde viral protein ve nükleik asitlerin ayrı izini tutmak için Kükürt (35 S) ve fosforun (32 P) radyoaktif izotoplarını kullanan bir deney tasarladı.

Fajların, 35 S veya 32 P radyoaktif izotoplarını içeren kültür ortamında bakterileri enfekte etmesine izin verildi. 35 S varlığında gelişen bakteriyofaj, etiketli proteinlere ve32P varlığında büyüyen bakteriyofajlar, etiketli DNA'ya sahipti. Böylece farklı etiketleme, fajın DNA'sını ve proteinlerini tanımlamalarını sağladı. Hershey ve Chase, etiketli fajları etiketlenmemiş E. coli ile karıştırdı ve bakteriyofajların genetik materyallerine saldırmasına ve enjekte etmesine izin verdi. Enfeksiyondan kısa bir süre sonra (bakterilerin parçalanmasından önce), bakteri hücreleri, yapışan faz partiküllerini gevşetmek için bir karıştırıcıda hafifçe çalkalandı.

Bakteri hücreleriyle ilişkili sadece 32P'nin bulunduğu ve bakteri hücrelerinde değil, çevreleyen ortamda 35S'nin bulunduğu gözlendi. Faj soyu radyoaktivite açısından incelendiğinde, 35 S değil, sadece 32 P taşıdığı bulundu. Bu sonuçlar, bakteri hücrelerine protein kaplamanın değil, sadece DNA'nın girdiğini açıkça göstermektedir. Böylece Hershey ve Chase, virüsten bakterilere kalıtsal bilgiyi taşıyanın protein değil, DNA olduğunu kesin olarak kanıtladılar.

Soru 76.
DNA'yı ideal bir genetik materyal yapan özelliklerini açıklayın.
Cevap:
1. Kendini Çoğaltma: Çoğaltabilmeli. Baz eşleşmesi ve tamamlayıcılık kuralına göre, her iki nükleik asit (DNA ve RNA) duplikasyonları yönlendirme yeteneğine sahiptir. Proteinler bu kriteri karşılayamaz.

2. Kararlılık: Yapısal ve kimyasal olarak kararlı olmalıdır. Genetik materyal, yaşam döngüsünün farklı evreleri, yaş veya organizmanın fizyolojisindeki değişikliklerle değişmeyecek kadar kararlı olmalıdır. Genetik materyalin özelliklerinden biri olarak kararlılık, Griffith'in dönüştürme ilkesinde açıkça görülüyordu. Bakterileri öldüren ısı, genetik materyalin bazı özelliklerini yok etmedi. DNA'da iki iplik birbirini tamamlayıcıdır.

ısıtılarak ayrılırsa (denatüre edilirse) uygun koşul sağlandığında bir araya gelebilir (renatürasyon). RNA'daki her nükleotitte bulunan daha fazla 2' OH grubu, RNA'yı sorumlu ve kolayca bozunabilir yapan reaktif bir gruptur. RNA'nın katalitik ve reaktif olduğu da bilinmektedir. Bu nedenle, DNA, RNA ile karşılaştırıldığında kimyasal olarak daha kararlı ve kimyasal olarak daha az reaktiftir. DNA'da urasil yerine timinin varlığı, DNA'ya ek stabilite sağlar.

3. Bilgi saklama: Mendel karakterleri şeklinde kendini ifade edebilmelidir. RNA, protein sentezini doğrudan kodlayabilir ve karakterleri kolayca ifade edebilir. Ancak DNA, proteinlerin sentezi için RNA'ya bağlıdır. Hem DNA hem de RNA genetik bir materyal gibi davranabilir, ancak DNA'nın daha kararlı olması genetik bilgiyi depolar ve RNA genetik bilgiyi aktarır.

4. Mutasyon yoluyla varyasyon: Mutasyona uğrayabilmeli. Hem DNA hem de RNA mutasyona uğrayabilir. RNA kararsız olduğundan daha hızlı mutasyona uğrar. Böylece daha kısa ömürlü RNA genomuna sahip virüsler daha hızlı mutasyona uğrayabilir ve evrimleşebilir. Yukarıdaki tartışma, hem RNA'nın hem de DNA'nın bir genetik materyal olarak işlev görebileceğini gösterir. DNA daha kararlıdır ve genetik bilginin depolanması için tercih edilir.

Soru 77.
DNA ökaryotik bir hücrede nasıl paketlenir? ft
Cevap:
Ökaryotlarda organizasyon daha karmaşıktır. Kromatin, nükleozom adı verilen bir dizi tekrar eden birimlerden oluşur. Komberg, nükleozom için, dört histon proteini H2A, H2B, H3 ve H4'ün 2 molekülünün, histon oktamer adı verilen sekiz molekülden oluşan bir birim oluşturacak şekilde düzenlendiği bir model önerdi. Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir. Histon oktamerleri yakın temas halindedir ve DNA, nükleozomun dışına sarılmıştır. Komşu nükleozomlar, enzimlere maruz kalan bağlayıcı DNA (HI) ile bağlanır.

DNA, histon oktamerleri etrafında iki tam dönüş yapar ve iki dönüş bir HI molekülü tarafından kapatılır. HI içermeyen kromatin, DNA'nın nükleozomları rastgele yerlerde araya girip bıraktığı bir ip üzerinde boncuk görünümüne sahiptir. Bir nükleozomun HI'sı, komşu nükleozomların 33l'si ile etkileşime girerek fiberin daha fazla katlanmasına neden olabilir.

İnterfaz çekirdeklerindeki ve mitotik kromozomlardaki chrof&atin lifi 200-300 nm arasında değişen çapa sahiptir ve inaktif kromatini temsil eder. 30 nm fiber, nucfeosbme zincirlerinin, dönüş başına altı nükleozom içeren bir solenoid yapıya katlanmasından doğar. Bu yapı, farklı HI molekülleri arasındaki etkileşim ile stabilize edilir. DNA bir solenoiddir ve yaklaşık,%)_kat paketlenmiştir. Kromozom yapısının hiyerarşik doğası gösterilmektedir.

Kromatinin daha yüksek seviyede paketlenmesi için ek ptein seti gereklidir ve bunlar histon olmayan kromozomal proteinler (NHC) olarak adlandırılır. Tipik bir çekirdekte*, kromatinin bazı bölgeleri İbose olarak paketlenir (hafif lekeli) ve ökromatin olarak adlandırılır. Sıkıca paketlenmiş (koyu lekeli) olan kromatine heterokromatin denir. Ökromatin transkripsiyonel olarak aktiftir ve heterokromatin transkripsiyonel olarak aktif değildir.

Soru 78.
Meselson ve Stahl'ın deneyi, DNA replikasyonunun yarı-kopyalama modunu kanıtladı. Açıklamak.
Cevap:
DNA replikasyonu modu 1958'de Meselson ve Stahl tarafından belirlendi.Yarı muhafazakar, muhafazakar ve dağınık çoğaltmaları ayırt etmek için bir deney tasarladılar. Deneylerinde, birçok nesil için ayrı ortamlarda iki E.coli kültürü yetiştirdiler. 'Ağır' kültür, nitrojen kaynağının (NH4CI) 15 N ağır izotopu içerdiği bir ortamda ve 'hafif' kültür, nitrojen kaynağının birçok nesiller için hafif izotop 14H içerdiği bir ortamda büyütüldü. Büyümenin sonunda, ağır kültürdeki bakteri DNA'sının sadece 15 N ve hafif kültürde sadece 14 N içerdiğini gözlemlediler. Ağır DNA, Sezyum adı verilen bir teknikle hafif DNA'dan (14 N'den 15 N) ayırt edilebildi. Klorür (CsCl) yoğunluk gradyanlı santrifüjleme. Bu süreçte, otuz iki kültürdeki hücrelerden ekstrakte edilen ağır ve hafif DNA, iki ayrı ve ayrı banda (hibrit DNA) yerleşir.

Ağır kültür (15 N) daha sonra sadece NH4CI içeren bir ortama aktarıldı ve çeşitli belirli zaman aralıklarında (20 dakika süre ile) numuneler aldı. İlk replikasyondan sonra DNA'yı çıkardılar ve yoğunluk gradyanlı santrifüjlemeye tabi tuttular. DNA, önceden belirlenmiş ağır ve hafif bantlar arasında orta konumda olan bir banda yerleşti. İkinci replikasyondan (40 dakika süre) sonra tekrar DNA örnekleri çıkardılar ve bu sefer DNA'nın biri hafif bant pozisyonunda diğeri ara pozisyonda olmak üzere iki banda yerleştiğini buldular. Bu sonuçlar Watson ve Crick'in yarı muhafazakar çoğaltma hipotezini doğrulamaktadır.

Soru 79.
Bir transkripsiyon biriminin ayrıntılı bir hesabını verin.
Cevap:
DNA'daki bir transkripsiyonel birim, bir promotör, yapısal gen ve bir terminatör olmak üzere üç bölge ile tanımlanır. Destekleyici 5 'ucuna doğru yer almaktadır. RNA polimeraz için bağlanma yeri sağlayan bir DNA dizisidir. Bir transkripsiyon ünitesinde promotörün varlığı, şablonu ve kodlama şeritlerini tanımlar. Kodlama zincirinin 3' ucuna doğru yer alan sonlandırıcı bölge, RNA polimerazın transkripsiyonu durdurmasına neden olan bir DNA dizisi içerir. Ökaryotlarda promotör, TATA kutusu (Goldberg-Hogness kutusu) ‘ adı verilen AT bakımından zengin bölgelere sahiptir ve prokaryotlarda bu bölgeye Pribnow kutusu denir.

Destekleyicinin yanı sıra ökaryotlar ayrıca bir geliştiriciye ihtiyaç duyar. Bir transkripsiyon ünitesinin yapısal genindeki DNA'nın iki ipliği zıt kutuplara sahiptir. DNA'ya bağımlı RNA polimeraz, polimerizasyonu sadece bir yönde katalize eder, 3'→5' polaritesine sahip iplik bir şablon görevi görür ve şablon iplik olarak adlandırılır. 5'→ 3' polaritesine sahip olan diğer iplik, RNA ile aynı diziye sahiptir (urasil yerine timin hariç) ve transkripsiyon sırasında yer değiştirir. Bu diziye kodlama dizisi denir.

Yapısal gen, monosistronik (ökaryotlar) veya polisistronik (prokaryotlar) olabilir. Ökaryotlarda, her mRNA yalnızca tek bir gen taşır ve yalnızca tek bir protein için bilgi kodlar ve monosistronik mRNA olarak adlandırılır. Prokaryotlarda, operon olarak bilinen, genellikle kromozom üzerinde yan yana bulunan ilgili gen kümeleri, tek bir mRNA vermek üzere birlikte kopyalanır ve bu nedenle polisistroniktir.

80. soru.
Prokaryotlarda transkripsiyon sürecini gerekli diyagramlarla açıklar.
Cevap:
Prokaryotlarda üç ana RNA türü vardır:
mRNA, tRNA ve rRNA'dır. Bir hücrede bir proteini sentezlemek için üç RNA'nın hepsine ihtiyaç vardır. mRNA şablonu sağlar, tRNA amino asitleri getirir ve genetik kodu okur ve rRNA'lar çeviri sırasında yapısal ve katalitik rol oynar. Her tür RNA'nın transkripsiyonunu katalize eden tek bir DNA'ya bağımlı RNA polimeraz vardır. Promotöre bağlanır ve transkripsiyonu başlatır (Başlatma).

Polimeraz bağlanma bölgelerine promotör denir. Substrat olarak nükleosit trifosfat ve tamamlayıcılık kuralına göre şablona bağlı bir şekilde polimerazlar kullanır. Transkripsiyonun başlamasından sonra, polimeraz, büyüyen RNA zincirine birbiri ardına bir nükleotid ekleyerek RNA'yı uzatmaya devam eder. Sadece kısa bir RNA parçası enzime bağlı kalır, polimeraz bir genin sonunda bir terminatöre ulaştığında, yeni oluşan RNA düşer, dolayısıyla RNA polimeraz da düşer. RNA polimeraz sadece uzama sürecini katalize etme yeteneğine sahiptir. RNA polimeraz, sırasıyla transkripsiyonu başlatmak ve sonlandırmak için başlatma faktörü sigma (a) ve sonlandırma faktörü rho (p) ile geçici olarak birleşir.

RNA'nın bu faktörlerle ilişkisi, RNA polimerazına transkripsiyon sürecini başlatması veya sonlandırması talimatını verir. Bakterilerde, mRNA'nın aktif hale gelmesi için herhangi bir işlem gerektirmediğinden ve ayrıca bakterilerde sitozol ve çekirdeğin ayrılması olmadığından transkripsiyon ve translasyon aynı anda aynı bölmede gerçekleştiğinden), çoğu kez çeviri mRNA'nın çok daha önce başlayabilir. tamamen transkripsiyonu. Bunun nedeni, genetik materyalin bir nükleer zar ile diğer hücre organellerinden ayrılmamış olmasıdır, dolayısıyla bakterilerde transkripsiyon ve translasyon birleştirilebilir.

81. soru
Genetik kodun belirgin özelliklerini yazınız.
Cevap:
Genetik kodun göze çarpan özellikleri aşağıdaki gibidir:

  1. Genetik kodon üçlü bir koddur ve 61 kodon amino asit kodudur ve 3 kodon herhangi bir amino asidi kodlamaz ve durdurma kodonu (Sonlandırma) olarak işlev görür.
  2. Genetik kod evrenseldir. Bu, bilinen tüm canlı sistemlerin nükleik asitleri kullandığı ve aynı üç baz kodonun (üçlü kodon) amino asitlerden protein sentezini yönlendirdiği anlamına gelir. Örneğin, mRNA (UUU) kodonu, tüm organizmaların tüm hücrelerinde fenilalanin için kodlar. Prokaryotik, mitokondriyal ve kloroplast genomlarında bazı istisnalar bildirilmiştir. Ancak benzerlikler farklılıklardan daha yaygındır.
  3. Örtüşmeyen bir kodon, aynı harfin iki farklı kodon için kullanılmadığı anlamına gelir. Örneğin, GUTJ ve GUC nükleotid dizisi sadece iki kodonu temsil eder.
  4. Virgülden daha azdır, bu da mesajın bir uçtan diğerine doğrudan okunacağı anlamına gelir, yani iki kod arasında noktalama işaretine gerek yoktur.
  5. Dejenere bir kod, birden fazla üçlü kodonun belirli bir amino asidi kodlayabileceği anlamına gelir. Örneğin, valin için kodonlar GUU, GUC, GUA ve GUG kodu.
  6. Belirsiz olmayan kod, bir kodonun bir amino asidi kodlayacağı anlamına gelir.
  7. Kod her zaman sabit bir yönde, yani polarite adı verilen 5'→3' yönünden okunur.
  8. AUG'nin çift işlevi vardır. Bir başlatıcı kodon görevi görür ve ayrıca metiyonin amino asidini kodlar.
  9. UAA, UAG (tirozin) ve UGA (triptofan) kodonları, sonlandırma (durdurma) kodonları olarak adlandırılır ve aynı zamanda “anlamsız” kodonlar olarak bilinir.

Soru 82.
Genetik koddaki mutasyonlar fenotipi etkiler. Örnekle açıklayın.
Cevap:
Moleküler düzeydeki en basit mutasyon türü, nükleotidde bir bazın diğeriyle yer değiştirdiği bir değişikliktir. Bu tür değişiklikler, kendiliğinden veya mutajenlerin etkisinden dolayı meydana gelebilen baz ikameleri olarak bilinir. İyi çalışılmış bir örnek, insanlarda β-hemoglobin geninin (βHb) bir alelinin nokta mutasyonundan kaynaklanan orak hücreli anemidir.

Bir hemoglobin molekülü, ikisi a zinciri ve ikisi P zinciri olmak üzere iki tipte dört polipeptit zincirinden oluşur. Her zincirin yüzeyinde bir hem grubu vardır. Hem grupları oksijenin bağlanmasında rol oynar. Jruman kan hastalığı, orak hücreli anemi anormal hemoglobinden kaynaklanır. Hemoglobindeki bu anormallik, hemoglobinin p-zincirinde GAG'dan GTG'ye beta globingenin altıncı kodonundaki tek bir baz ikamesinden kaynaklanır.

P zincirinin 6. pozisyonunda amino asit glufeniik asidin valine değişmesiyle sonuçlanır. Bu, amino asit kalıntısı glutamik asidin valine dönüşmesiyle sonuçlanan nokta mutasyonunun klasik örneğidir. Mutant hemoglobin, oksijen gerilimi altında polimerizasyona uğrayarak RBC'nin şeklinin bikonkavdan orak şekilli bir yapıya dönüşmesine neden olur.

Soru 83.
E-coli'nin AteArperon mekanizmasını açıklayın.
Cevap:
Lac (Laktoz) operonu: E.coli'deki laktoz metabolizması, üç enzim – permeaz, P-galaktosidaz (P-gat) ve transasetilaz gerektirir. Laktozun hücreye girişi için permeaz enzimi gereklidir, Pjgglactosidase laktozun glikoz ve galaktoza hidrolizini sağlarken, transasety g asetil grubunu asetil Co A'dan P-galaktosidaza aktarır. Lac operon, tek düzenleyici genden (T geni inhibitör anlamına gelir) promotör sitelerinden (p) ve operatör bölgesinden (o) oluşur. Bunların yanı sıra lac z, y ve lac a olmak üzere üç yapısal geni vardır. lac 'z' geni P-gaiaqtttsidase için, lac 'y' geni permeaz için ve 'a' geni transasetilaz için kodlar.

Jacob ve Monod, E.coli'deki gen ekspresyonunu ve regülasyonunu açıklamak için klasik Lac operon modelini önerdiler. Lac'ta bir polisistronik yapısal gen, ortak bir promotör ve düzenleyici genfc tarafından düzenlenir. Hücre normal enerji kaynağını glikoz olarak kullandığında, "i" geni bir baskılayıcı mRNA'yı kopyalar ve translasyonundan sonra bir baskılayıcı protein üretilir. Operonun operatör bölgesine bağlanır ve translasyonu önler, bunun sonucunda P-galaktosidaz üretilmez. Glikoz gibi tercih edilen karbon kaynağının yokluğunda, bakteri için bir enerji kaynağı olarak laktoz mevcutsa, laktoz hücreye permeaz enzimi sonucu girer. Laktoz bir indükleyici görevi görür ve onu etkisiz hale getirmek için baskılayıcı ile etkileşime girer.

Baskılayıcı protein, operonun operatörüne bağlanır ve RNA polimerazın operonu kopyalamasını engeller. Laktoz veya allolaktoz gibi indükleyicinin mevcudiyetinde, represör indükleyici ile etkileşim yoluyla etkisiz hale getirilir. Bu, RNA polimerazın promotor bölgeye bağlanmasına ve laktoz metabolizması için gerekli tüm gerekli enzimlerin oluşumunu sağlayan lac mRNA'yı üretmek için operonu kopyalamasına izin verir. Lac operonunun baskılayıcı tarafından düzenlenmesi, transkripsiyon başlangıcının negatif kontrolünün bir örneğidir.

Soru 84.
İnsan Genom projesinin amaçları nelerdir?
Cevap:
İnsan Genom Projesinin ana hedefleri aşağıdaki gibidir:

  1. İnsan DNA'sındaki tüm genleri (yaklaşık 30000) tanımlayın.
  2. İnsan DNA'sını oluşturan üç milyar kimyasal baz çiftinin sırasını belirleyin.
  3. Bu bilgileri veritabanlarında saklamak için.
  4. Veri analizi için araçları geliştirin.
  5. İlgili teknolojileri endüstriler gibi diğer sektörlere aktarın.
  6. Projeden doğabilecek etik, yasal ve sosyal sorunları (ELSI) ele alın.

85. soru
İnsan Genom Projesinin göze çarpan özelliklerini yazınız.
Cevap:

  1. İnsan genomu 3 milyar nükleotid bazı içermesine rağmen, proteinleri kodlayan DNA dizileri genomun sadece %5'ini oluşturur.
  2. Ortalama bir gen 3000 bazdan oluşur, bilinen en büyük insan geni 2.4 milyon baz ile distrofindir.
  3. Genomun %50'sinin işlevi, LINE ve ALU dizisi gibi yer değiştirebilir elemanlardan türetilir.
  4. Genler 24 kromozom üzerinde dağıtılır. Kromozom 19, en yüksek gen yoğunluğuna sahiptir. Kromozom 13 ve Y kromozomu en düşük gen yoğunluğuna sahiptir.
  5. İnsan genlerinin kromozomal organizasyonu çeşitlilik gösterir.
  6. Genomda 35000-40000 gen olabilir ve neredeyse 99.9 nükleotid bazı tüm insanlarda tamamen aynıdır.
  7. Keşfedilen genlerin yüzde 50'sinden fazlasının işlevleri bilinmiyor.
  8. Proteinler için genom kodlarının yüzde 2'sinden azı.
  9. Tekrarlanan diziler, insan genomunun çok büyük bir bölümünü oluşturur. Tekrarlayan dizilerin doğrudan kodlama işlevi yoktur ancak kromozom yapısı, dinamikleri ve evrimine (genetik çeşitlilik) ışık tutarlar.
  10. Kromozom 1'de 2968 gen bulunurken, 'Y' kromozomunda 231 gen bulunur.
  11. Bilim adamları, insanlarda tek baz DNA farklılıklarının (SNP'ler – Tek nükleotid polimorfizm – 'kesintiler' olarak telaffuz edilir) meydana geldiği yaklaşık 1,4 milyon konum belirlediler. 'SNIPS'in tanımlanması, hastalıkla ilişkili diziler için kromozomal konumların bulunmasında ve insanlık tarihinin izlenmesinde yardımcı olur.

Soru 86.
DNA parmak izi tekniğinde yer alan prensibi açıklayın.
Cevap:
DNA parmak izi tekniği ilk olarak 1985 yılında Alec Jeffreys tarafından geliştirilmiştir. Bir kişinin DNA'sı ve parmak izleri benzersizdir. 1.5 milyon çift gen içeren 23 çift insan kromozomu vardır. Genlerin, nükleotid dizilimlerinde farklılık gösteren DNA parçaları olduğu iyi bilinen bir gerçektir. DNA'nın tüm segmentleri proteinler için kod oluşturmaz, bazı DNA segmentleri düzenleyici bir işleve sahipken, diğerleri araya giren dizilerdir (intronlar) ve yine diğerleri tekrarlanan DNA dizileridir. DNA parmak izinde, kısa tekrarlayan nükleotid dizileri kişiye özeldir. Bu nükleotid dizileri, değişken sayılı tandem tekrarları (VNTR) olarak adlandırılır. İki kişinin VNTR'leri genellikle çeşitlilik gösterir ve genetik belirteçler olarak faydalıdır.

DNA parmak izi, DNA dizisindeki tekrarlayan DNA adı verilen bazı spesifik bölgelerdeki farklılıkları tanımlamayı içerir, çünkü bu dizilerde küçük bir DNA dizisi birçok kez tekrarlanır. Bu tekrarlayan DNA, yoğunluk gradyanlı santrifüjleme sırasında farklı tepe noktaları olarak toplu genomik DNA'dan ayrılır. Toplu DNA büyük bir tepe noktası oluşturur ve diğer küçük tepe noktaları uydu DNA olarak adlandırılır. Baz bileşimine (A: T bakımından zengin veya G: C bakımından zengin), segmentin uzunluğuna ve tekrarlayan birimlerin sayısına bağlı olarak, uydu DNA'sı, mikro uydular ve mini uydular vb. gibi birçok alt kategoride sınıflandırılır.

Bu diziler herhangi bir proteini kodlamaz, ancak insan genomunun büyük bir bölümünü oluştururlar. Bu diziler yüksek derecede polimorfizm gösterir ve DNA parmak izinin temelini oluşturur. Bir suç mahallinde bırakılan kan, saç, deri hücreleri veya diğer genetik kanıtlardan izole edilen DNA, suçlu veya masum olup olmadığını belirlemek için suçlu bir şüphelinin DNA'sı ile VNTR kalıpları aracılığıyla karşılaştırılabilir. VNTR kalıpları, delil olarak bulunan DNA'dan veya vücudun kendisinden bir cinayet kurbanının kimliğini belirlemede de yararlıdır.

Soru 87.
DNA parmak izi tekniğinin adımlarını gösteren bir akış şeması çizin
Cevap:

Üst Düzey Düşünme Becerileri (HOT) Soruları

Soru 1.
Bir mRNA zinciri, ilk üç kodonu aşağıda verilen bir dizi üçlü kodona sahiptir.
(a) AĞUSTOS
(b) UUU
(c) UGC
(i) Bu üçlü kodonlar tarafından kodlanan amino asidi adlandırın.
(ii) Bu üçlü kodonların kopyalanacağı DNA dizisinden bahseder misiniz?
Cevap:
(i) Metionin için AUG kodları
Fenilalanin için UUU kodları
Sistein için UGC kodları
(ii) DNA'nın TAC dizisi AUG'ye kopyalanır
AAA DNA dizisi UUU'ya kopyalanır
ACG DNA dizisi UGC'ye kopyalanır

Soru 2.
Aşağıda, translasyon sürecinde yer alan tRNA moleküllerinin yapıları verilmiştir. Bir tRNA'da kodondan bahsedilir ancak amino asitten bahsedilmez. Başka bir tRNA molekülünde kodon değil amino asit adlandırılır. İlgili amino asitleri ve kodonları belirterek şekli tamamlayın.
Cevap:

Soru 3.
Bir DNA parçası, 32 adenin bazına ve 32 sitozin bazına sahiptir. Bu DNA parçası toplam kaç nükleotid içerir? Açıklamak.
Cevap:
128 nükleotid. Adenin her zaman Timin bazını eşleştirir. 32 adenin bazı varsa, o zaman 32 Timin bazı olmalıdır. Benzer şekilde sitozin guanin ile eşleşir. Sitozin bazlarının sayısı 32 ise, guanin bazları sitozin'e eşit olacaktır. Böylece toplam 128 nükleotit yapar.

Soru 4.
Aşağıda, bu A türevi kullanılarak TAC TCG CCC TAT UAA CCC AAA ACC TCT geninin bir bölümünü temsil eden bir DNA dizisi verilmiştir.


66 Modern Anlayışın Tarihsel Temeli

Bu bölümün sonunda aşağıdakileri yapabileceksiniz:

  • DNA'nın dönüşümünü açıklayın
  • DNA'nın genetik materyal olduğunu belirlemeye yardımcı olan temel deneyleri tanımlayın
  • Chargaff kurallarını belirtin ve açıklayın

Mevcut DNA anlayışımız, nükleik asitlerin keşfi ve ardından çift sarmal modelinin geliştirilmesiyle başladı. 1860'larda, mesleği hekim olan Friedrich Miescher ((Şekil)), beyaz kan hücrelerinden (lökositler) fosfat açısından zengin kimyasalları izole etti. Bu kimyasalları isimlendirdi (sonunda DNA olarak bilinecekti) nüklein çünkü hücre çekirdeğinden izole edilmişlerdi.


Miescher'ın DNA'yı ve çekirdekteki ilişkili proteinleri keşfetmesine yol açan deneyini yürüttüğünü görmek için bu incelemeye tıklayın.

Yarım yüzyıl sonra, 1928'de İngiliz bakteriyolog Frederick Griffith, bakteriyel transformasyonun ilk gösterimini bildirdi - bir hücre tarafından dış DNA'nın alındığı, böylece morfolojisini ve fizyolojisini değiştiren bir süreç. Griffith deneylerini streptokok pnömoni, pnömoniye neden olan bir bakteri. Griffith, bu bakterinin kaba (R) ve pürüzsüz (S) olarak adlandırılan iki suşu ile çalıştı. (İki hücre tipi, bir besleyici agar plakasında büyütülmüş kolonilerinin ortaya çıkmasından sonra "kaba" ve "pürüzsüz" olarak adlandırıldı.)

R suşu patojenik değildir (hastalığa neden olmaz). S suşu patojeniktir (hastalığa neden olur) ve hücre duvarının dışında bir kapsülü vardır. Kapsül, hücrenin konak farenin bağışıklık tepkilerinden kaçmasına izin verir.

Griffith, canlı S türünü farelere enjekte ettiğinde, zatürreden öldüler. Buna karşılık, Griffith canlı R suşunu farelere enjekte ettiğinde hayatta kaldılar. Başka bir deneyde, farelere ısıyla öldürülen S suşu enjekte ettiğinde, onlar da hayatta kaldı. Bu deney, kapsülün tek başına ölüm nedeni olmadığını gösterdi. Üçüncü bir deney setinde, farelere canlı R suşu ve ısıyla öldürülmüş S suşu karışımı enjekte edildi ve -şaşırmasına rağmen- fareler öldü. Canlı bakterilerin ölü fareden izole edilmesi üzerine, sadece bakteri S suşu geri kazanıldı. Bu izole edilmiş S suşu, taze farelere enjekte edildiğinde, fareler öldü. Griffith, ısıyla öldürülen S suşundan canlı R suşuna bir şeyin geçtiği ve onu patojenik S suşuna dönüştürdüğü sonucuna vardı. Bunu o çağırdı dönüştürme ilkesi ((Figür)). Bu deneyler artık Griffith'in dönüşüm deneyleri olarak biliniyor.


Bilim adamları Oswald Avery, Colin MacLeod ve Maclyn McCarty (1944), bu dönüştürücü ilkeyi daha fazla keşfetmekle ilgilendiler. S türünü ölü farelerden izole ettiler ve proteinleri ve nükleik asitleri (RNA ve DNA) kalıtım molekülü için olası adaylar olarak izole ettiler. Her bir bileşeni spesifik olarak bozunduran enzimler kullandılar ve daha sonra R suşunu dönüştürmek için her karışımı ayrı ayrı kullandılar. DNA bozulduğunda, ortaya çıkan karışımın artık bakterileri dönüştüremediğini, diğer tüm kombinasyonların ise bakterileri dönüştürebildiğini buldular. Bu onları DNA'nın dönüştürücü ilke olduğu sonucuna varmalarına yol açtı.

Adli Bilim Adamı Adli Bilimciler, bir göçmenlik davasını çözmek için ilk kez DNA analizi kanıtlarını kullandılar. Hikaye, Gana'dan Londra'ya dönen genç bir çocuğun annesiyle birlikte olmasıyla başladı. Havaalanındaki göçmenlik makamları, sahte bir pasaportla seyahat ettiğini düşünerek ondan şüphelendi. Çok ikna edildikten sonra annesiyle yaşamasına izin verildi, ancak göçmenlik makamları aleyhindeki davayı düşürmedi. Fotoğraflar da dahil olmak üzere her türlü delil yetkililere sunuldu, ancak buna rağmen sınır dışı işlemleri başlatıldı. Aynı zamanda, Birleşik Krallık'taki Leicester Üniversitesi'nden Dr. Alec Jeffreys, DNA parmak izi olarak bilinen bir teknik icat etmişti. Göçmenlik makamları yardım için Dr. Jeffreys'e başvurdu. Anne ve üç çocuğunun yanı sıra akraba olmayan bir anneden DNA örnekleri aldı ve örnekleri çocuğun DNA'sıyla karşılaştırdı. Biyolojik baba resimde olmadığı için, üç çocuğun DNA'sı, çocuğun DNA'sı ile karşılaştırıldı. Çocuğun DNA'sında hem anne hem de üç kardeşi için bir eşleşme buldu. Çocuğun gerçekten de annesinin oğlu olduğu sonucuna vardı.

Adli bilim adamları, belgeler, el yazısı, ateşli silahlar ve biyolojik örnekler dahil olmak üzere birçok öğeyi analiz eder. Saç, meni, tükürük ve kanın DNA içeriğini analiz ederler ve bunu bilinen suçluların DNA profillerinin bir veri tabanıyla karşılaştırırlar. Analiz, DNA izolasyonu, dizileme ve dizi analizini içerir. Adli bilim adamlarının bulgularını sunmak için mahkeme duruşmalarına çıkmaları bekleniyor. Genellikle şehir ve eyalet devlet kurumlarının suç laboratuvarlarında kullanılırlar. DNA teknikleriyle deneyler yapan genetikçiler aynı zamanda bilim ve araştırma kuruluşları, ilaç endüstrileri ve kolej ve üniversite laboratuvarlarında da çalışırlar. Adli bilim adamı olarak kariyer yapmak isteyen öğrenciler, kimya, biyoloji veya fizik alanında en az lisans derecesine ve tercihen bir laboratuvarda çalışma deneyimine sahip olmalıdır.

Avery, McCarty ve McLeod'un deneyleri, DNA'nın dönüşüm sırasında aktarılan bilgi bileşeni olduğunu gösterse de, DNA'nın hala biyolojik bilgiyi taşıyamayacak kadar basit bir molekül olduğu düşünülüyordu. Proteinler, 20 farklı amino asitleri ile daha olası adaylar olarak kabul edildi. 1952'de Martha Chase ve Alfred Hershey tarafından yürütülen belirleyici deney, DNA'nın gerçekten proteinler değil, genetik materyal olduğuna dair doğrulayıcı kanıtlar sağladı. Chase ve Hershey bir bakteriyofaj, yani bakterileri enfekte eden bir virüs üzerinde çalışıyorlardı. Virüsler tipik olarak basit bir yapıya sahiptir: kapsid adı verilen bir protein kaplaması ve genetik materyali (DNA veya RNA) içeren bir nükleik asit çekirdeği. Bakteriyofaj, yüzeyine yapışarak konak bakteri hücresini enfekte eder ve daha sonra nükleik asitlerini hücre içine enjekte eder. Faj DNA'sı, konak makineyi kullanarak kendisinin birden fazla kopyasını oluşturur ve sonunda konakçı hücre patlayarak çok sayıda bakteriyofaj serbest bırakır. Hershey ve Chase, enfekte hücrelerdeki proteini DNA'dan spesifik olarak ayırt edecek radyoaktif elementleri seçtiler. Protein kaplamasını etiketlemek için bir grup fajı radyoaktif kükürt, 35 S ile etiketlediler. Başka bir faj grubu, radyoaktif fosfor,32P ile etiketlendi. DNA'da fosfor bulunduğundan, protein bulunmadığından, protein değil DNA radyoaktif fosfor ile etiketlenecektir. Benzer şekilde, kükürt DNA'da bulunmaz, ancak metionin ve sistein gibi birkaç amino asitte bulunur.

Her faj partisinin hücreleri ayrı ayrı enfekte etmesine izin verildi. Enfeksiyondan sonra, faj bakteriyel süspansiyonu, faj kaplamasının konakçı hücreden ayrılmasına neden olan bir karıştırıcıya konuldu. Enfeksiyonun oluşması için yeterince uzun süre maruz kalan hücreler daha sonra iki radyoaktif molekülden hangisinin hücreye girdiğini görmek için incelendi. Faj ve bakteri süspansiyonu bir santrifüjde döndürüldü. Daha ağır bakteri hücreleri yerleşip bir pelet oluştururken, daha hafif faj parçacıkları süpernatanda kaldı. 35 S ile etiketlenmiş faj içeren tüpte, süpernatan radyoaktif olarak etiketlenmiş faj içerirken, pelette hiçbir radyoaktivite tespit edilmedi. 32P ile etiketlenmiş faj içeren tüpte, daha ağır bakteri hücrelerini içeren pelette radyoaktivite tespit edildi ve süpernatanda hiçbir radyoaktivite tespit edilmedi. Hershey ve Chase, enjekte edilenin faj DNA'sı olduğu sonucuna vardılar.
hücreye girer ve daha fazla faj parçacığı üretmek için bilgi taşır, böylece DNA'nın protein değil, genetik materyal olduğuna dair kanıt sağlar ((Şekil)).


Aynı sıralarda, Avusturyalı biyokimyacı Erwin Chargaff, farklı türlerdeki DNA içeriğini inceledi ve adenin, timin, guanin ve sitozin miktarlarının eşit miktarlarda bulunmadığını ve dört nükleotid bazının nispi konsantrasyonlarının türden türe farklılık gösterdiğini buldu. türlere değil, aynı bireyin dokuları içinde veya aynı türün bireyleri arasında değil. Ayrıca beklenmedik bir şey keşfetti: Adenin miktarının timin miktarına eşit olduğu ve sitozin miktarının guanin miktarına eşit olduğu (yani, A = T ve G = C). Farklı türlerin eşit miktarda pürinler (A+G) ve pirimidinler (T + C), ancak farklı A+T ila G+C oranları. Bu gözlemler Chargaff kuralları olarak bilinir hale geldi. Watson ve Crick, DNA çift sarmal modellerini önermeye hazırlanırken Chargaff'ın bulguları son derece yararlı oldu! Son birkaç sayfayı okuduktan sonra, bilimin, bazen yavaş ve zahmetli bir süreçte, önceki keşifler üzerine nasıl inşa edildiğini görebilirsiniz.

Bölüm Özeti

DNA ilk olarak, çekirdekten izole edildiği için ona nüklein adını veren Friedrich Miescher tarafından beyaz kan hücrelerinden izole edildi. Frederick Griffith'in suşlarla yaptığı deneyler streptokok pnömoni DNA'nın dönüştürücü ilke olabileceğine dair ilk ipucunu sağladı. Avery, MacLeod ve McCarty, bakterilerin transformasyonu için DNA'nın gerekli olduğunu gösterdi. Daha sonra Hershey ve Chase tarafından bakteriyofaj T2 kullanılarak yapılan deneyler, DNA'nın genetik materyal olduğunu kanıtladı. Chargaff, A = T ve C = G oranının ve A, T, G ve C'nin yüzde içeriğinin farklı türler için farklı olduğunu buldu.

Soruları İncele

Belirli bir türün DNA'sı analiz edilirse ve yüzde 27 A içerdiği bulunursa, C yüzdesi ne olur?

Hershey ve Chase tarafından yapılan deneyler, DNA'nın aşağıdaki bulgulara dayanarak kalıtsal materyal olduğunu doğrulamaya yardımcı oldu:

  1. pelette radyoaktif faj bulundu
  2. süpernatanda radyoaktif hücreler bulundu
  3. hücrenin içinde radyoaktif kükürt bulundu
  4. hücrede radyoaktif fosfor bulundu

Bakteriyel dönüşüm birçok tıbbi ortamda büyük bir endişe kaynağıdır. Sağlık hizmeti sağlayıcıları neden endişe duyabilir?

  1. Patojenik bakteriler, patojenik olmayan bakterilerde hastalığa neden olan genleri tanıtabilir.
  2. Antibiyotik direnç genleri, "süper böcekler" yaratmak için yeni bakterilere tanıtılabilir.
  3. Bakteriyofajlar, toksinleri kodlayan DNA'yı yeni bakterilere yayabilir.
  4. Yukarıdakilerin hepsi.

Eleştirel Düşünme Soruları

Griffith'in dönüşüm deneylerini açıklayın. Onlardan ne sonuç çıkardı?

Canlı R hücreleri, R hücrelerini S hücrelerine “dönüştüren” ısıyla öldürülen S hücrelerinden genetik bilgi aldı.

Hershey ve Chase'in deneylerinde bakteriyofajı etiketlemek için neden radyoaktif kükürt ve fosfor kullanıldı?

Kükürt, proteinlerde bulunan bir elementtir ve fosfor, nükleik asitlerin bir bileşenidir.

Chargaff deneylerini yaparken, DNA'nın GACT nükleotid tekrarlarından oluştuğunu ifade eden tetranükleotid hipotezi, DNA'nın kompozisyonu hakkında en çok kabul gören görüştü. Chargaff bu hipotezi nasıl çürüttü?

Tetranükleotid hipotezi doğru olsaydı, o zaman DNA'nın dört nükleotidin tümünü eşit miktarda içermesi gerekirdi (A=T=G=C). Bununla birlikte, Chargaff, A=T ve G=C'nin olduğunu, ancak dört nükleotidin eşit miktarlarda bulunmadığını gösterdi.


Martha Chase: Kitaplar İçin

Hershey-Chase deneyi, DNA'nın protein üzerindeki genetik bilginin taşıyıcısı olarak işlevini sağlamlaştıran tarihi çalışmadır.

Martha Chase

Martha Chase, çığır açan çalışmaları yürüten Alfred Hershey ile ikilinin bir parçası olan Amerikalı bir genetikçiydi. Çalışma, 1969'da Hershey'e Nobel Fizyoloji veya Tıp Ödülü'nü kazandırdı ve Max Delbrück ve Salvador Luria ile "virüslerin genetik yapısıyla ilgili keşifleri" nedeniyle paylaştı. Chase'in ödülden dışlanması bir sır olarak kalır. Bazıları Chase'in çalışmaya yaptığı entelektüel katkıların yanı sıra ekipte baş araştırmacı değil araştırma asistanı olduğu gerçeğini sorguluyor. Bununla birlikte, tarihi Hershey-Chase deneyinin adını içerdiği göz önüne alındığında, katkısı açıktır. Bu nedenle, Nobel Ödülü'nün o zamanki ataerkil tutumlarla ilgili olabileceği tahmin edilebilir.

Chase, 1927'de Ohio, Cleveland'da doğdu ve 1950'de College of Wooster'dan lisans derecesi aldı. 1959'da okula dönmeden önce, Cold Spring Harbor Laboratuvarı'nda bakteriyolog ve genetikçi Alfred Hershey'in laboratuvarında araştırma görevlisi olarak çalıştı. 1964'te Güney Kaliforniya Üniversitesi'nden Mikrobiyoloji alanında doktora derecesi aldı.

Chase, Kaliforniya'da 1950'lerin sonlarında bilim adamı arkadaşı Richard Epstein ile tanıştı ve evlendi ve adını Martha C. Epstein olarak değiştirdi. Evlilik birkaç yıl sonra boşanmayla sonuçlandı. Bundan sonra, 1960'lardaki bazı kişisel aksilikler, onun bilimsel kariyerine son vermesine neden oldu. Ailesiyle birlikte yaşamak için Ohio'ya geri döndü ve sonraki yıllarda kısa süreli hafıza kaybına yol açan bunama geliştirdi. 8 Ağustos 2003'te 75 yaşında zatürreden öldü.

Doktora öncesi 1950'lerde Hershey'in laboratuvarında geçirdiği süre boyunca, o ve Hershey, DNA'nın genetik bilginin taşıyıcısı ve vericisi olduğunu doğrulamaya yardımcı olan Hershey-Chase deneyini gerçekleştirdi.

Hershey-Chase deneyi aslında Hershey ve Chase tarafından yürütülen ve DNA'nın bir hücrenin genetik materyali olarak hizmet ettiği sonucuna varmalarına yardımcı olan bir dizi deneydi. DNA'nın yapısı birkaç yıl önce Rosalind Franklin, James Watson, Francis Crick ve Maurice Wilkins'ten oluşan bir grup tarafından aydınlatılmış olsa da, işlevi büyük ölçüde bilinmiyordu. Aynı zamanda, DNA'nın böyle bir rolü üstlenemeyecek kadar inert olduğu ve aynı zamanda çekirdekte korunduğu için proteinin genetik bilginin taşıyıcısı olduğu düşünülüyordu.

Deneylerde, Hershey ve Chase, hem DNA hem de proteinden oluşan radyoaktif olarak etiketlenmiş bakteriyofajlarla (özellikle bakterileri enfekte eden virüsler) bakterileri enfekte etti. Bakteriyofajlar, DNA'larını hücrelere enjekte eder, ancak esas olarak dış zarflarının veya kapsidinin bir bileşeni olan proteini değil. Radyoaktif etiketler aracılığıyla, ikisinden hangisinin, DNA veya proteinin bakteriye enjekte edildiğini izleyebildiler.

Biri DNA'yı etiketlemek için radyoaktif fosforla, diğeri proteini etiketlemek için radyoaktif kükürtle (DNA kükürt içermez ve protein fosfat grupları içermez) olmak üzere iki deney yaptılar. Deneylerin her birinde, radyoaktif sinyalin hücrede mi yoksa hücre dışında mı bulunduğuna baktılar.

Deney, enfeksiyondan sonra bakterileri virüslerden ayırmak için bir Waring mutfak blenderi kullanıldığından “Waring blender deneyi” olarak da bilinir. Ayırma işleminden sonra, karışım santrifüjlendi, bu, bakteri hücrelerinin dış zar bütünlüğünü yok etmek ve böylece bakterilerin dışına bağlı herhangi bir fajı çıkarmak için yapıldı. Bu arada, hücrelere giren herhangi bir radyoaktif madde sağlam ve tespit edilebilir olacaktır.

Deney, radyoaktif fosfor örneğinde etiketli parçacıkların yüzde 40'ının çıkarıldığını, kükürt etiketli örnekte ise etiketli parçacıkların yüzde 80'inin çıkarıldığını ortaya koydu. Fajlardan DNA'dan daha fazla protein bakterilerden uzaklaştırıldığından, sonuçlar DNA'nın protein yerine hücrelere kolayca girebildiğini gösterdi. Ve DNA bakterilerin içine girdiği için genetik bilginin taşıyıcısıydı ve üremede rol oynadı.

Çalışmaları için resmi övgüler, yani Nobel Ödülü kazanmamasına rağmen, Chase'in çalışması, moleküler biyoloji veya genetik öğrencisi bir ders kitabını her aldığında ve üzerine adının damgasını vurduğu temel Hershey-Chase deneyini okuduğunda kesinlikle tanınır. kelimenin tam anlamıyla.


Tamilnadu Samacheer Kalvi 12. Biyo Zooloji Çözümleri Bölüm 5 Moleküler Genetik

İster Bio Zoology uzmanı olmak ister sınavda iyi notlar almak isteyin, tek çözümünüz var Samacheer Kalvi 12th Bio Zoology Chapter wise Solutions ile pratik yapmak. Sitemizde Samacheer Kalvi 12th Bio Zoology Bölüm 5 Moleküler Genetik Soruları ve Cevaplarını öğrenerek zayıflığınızı güçlendirin. Web sitemizden doğrudan çevrimiçi öğrenebilir veya Samacheer Kalvi 12th Bio Zoology Chapter bilge materyalini indirerek çevrimdışı öğrenebilirsiniz. Zamandan tasarruf edin ve Samacheer Kalvi 12. Biyolojik Zooloji Konusunu konfor seviyenizde okuyun.

Samacheer Kalvi 12. Biyo Zooloji Moleküler Genetik Ders Kitabı Geri Sorular ve Cevaplar

Soru 1.
Bakteriyofaj ile Hershey ve Chase deneyi gösterdi ki
(a) Protein bakteri hücrelerine girer
(b) DNA genetik materyaldir
(c) DNA radyoaktif kükürt içerir
(d) Virüsler dönüşüme uğrar
Cevap:
(b) DNA genetik materyaldir

Soru 2.
DNA ve RNA birbirine benzer
(a) Azot bazı olarak timin
(b) Tek iplikli bir sarmal şekli
(c) Nükleotid içeren şekerler, nitrojen bazları ve fosfatlar
(d) Amino asit fenil alanin için aynı nükleotid dizisi
Cevap:
(c) Nükleotid içeren şekerler, nitrojen bazları ve fosfatlar

Soru 3.
Bir mRNA molekülü tarafından üretilir
(a) Çoğaltma
(b) Transkripsiyon
(c) Çoğaltma
(d) Tercüme
Cevap:
(b) Transkripsiyon

Soru 4.
İnsan genomundaki toplam azotlu baz sayısının yaklaşık olduğu tahmin edilmektedir.
(a) 3.5 milyon
(b) 35000
(c) 35 milyon
(d) 3,1 milyar
Cevap:
(d) 3,1 milyar

Soru 5.
15N ortam üzerinde büyütülen E. coli hücresi, 14N ortama aktarılır ve iki nesil boyunca büyümesine izin verilir. Bu hücrelerden ekstrakte edilen DNA, bir sezyum klorür yoğunluk gradyanında ultrasantrifüjlenir. Bu deneyde DNA'nın hangi yoğunluk dağılımını beklersiniz?
(a) Bir yüksek ve bir düşük yoğunluklu bant
(b) Bir ara yoğunluk bandı
(c) Bir yüksek ve bir orta yoğunluk bandı
(d) Bir düşük ve bir orta yoğunluk bandı
Cevap:
(d) Bir düşük ve bir orta yoğunluk bandı

Soru 6.
DNA moleküllerinin önde gelen ve gecikmeli zincirinin sentezindeki farkın temeli nedir?
(a) Replikasyonun kaynağı moleküllerin sadece 5' ucunda gerçekleşir.
(b) DNA ligazı sadece 3' → 5' yönünde çalışır
(c) DNA polimeraz, yeni nükleotidlere yalnızca büyüyen standın 3' ucuna kadar katılabilir.
(d) 5' ucunda çalışan sarmallar ve tek iplikli bağlayıcı proteinler
Cevap:
(d) 5' ucunda çalışan sarmallar ve tek iplikli bağlayıcı proteinler

7. soru
Aşağıdakilerden hangisi merkezi dogma ile ilgili doğru olay dizisidir?
(a) Transkripsiyon, Tercüme, Çoğaltma
(b) Transkripsiyon, Çoğaltma, Tercüme
(c) Çoğaltma, Tercüme, Transkripsiyon
(d) Çoğaltma, Transkripsiyon, Çeviri
Cevap:
(d) Çoğaltma, Transkripsiyon, Çeviri

Soru 8.
DNA replikasyonu ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
(a) DNA molekülünün çözülmesi, hidrojen bağları koptuğunda meydana gelir.
(b) Çoğaltma, her bir baz tam olarak kendisine benzeyen başka bir bazla eşleştirildiğinde gerçekleşir.
(c) Proses, yeni molekülde eski bir iplik korunduğu için yarı konservatif replikasyon olarak bilinir.
(d) Tamamlayıcı baz çiftleri hidrojen bağlarıyla bir arada tutulur
Cevap:
(b) Çoğaltma, her bir baz tam olarak kendisine benzeyen başka bir bazla eşleştirildiğinde gerçekleşir.

Soru 9.
Ökaryotlarda DNA replikasyonu ile ilgili aşağıdaki ifadelerden hangisi yanlıştır?
(a)) Çoğaltma, tek bir çoğaltma kaynağında başlar.
(b) Çoğaltma, kökenlerden iki yönlüdür.
(c) Replikasyon, dakikada yaklaşık 1 milyon baz çiftinde gerçekleşir.
(d) Her birinde aynı anda meydana gelen replikasyon ile çok sayıda farklı bakteri kromozomu vardır.
Cevap:
(d) Her birinde aynı anda meydana gelen replikasyon ile çok sayıda farklı bakteri kromozomu vardır.

Soru 10.
Şifresi çözülecek ilk kodon, hangi kodun şifrelendiğiydi.
(a) AAA, prolin
(b) GGG, alanin
(c) UUU, Fenilalanin
(d) TTT, arginin
Cevap:
(c) UUU, Fenilalanin

Soru 11.
Meselson ve Stahl'ın deneyi kanıtladı __________
(a) İletim
(b) Dönüşüm
(c) DNA genetik materyaldir
(d) DNA replikasyonunun yarı muhafazakar doğası
Cevap:
(d) DNA replikasyonunun yarı muhafazakar doğası

Soru 12.
Ribozomlar iki alt birimden oluşur, bir ribozomun daha küçük alt biriminin bir bağlanma yeri vardır ve daha büyük alt birimin iki bağlama yeri vardır.
Cevap:
mRNA, tRNA

Soru 13.
Anoperonisa:
(a) Gen ifadesini baskılayan protein
(b) Gen ifadesini hızlandıran protein
(c) İlgili işleve sahip yapısal genler kümesi
(d) Diğer genleri açıp kapatan gen
Cevap:
(d) Diğer genleri açıp kapatan gen

Soru 14.
Kültür ortamında laktoz bulunduğunda:
(a) Dantelli, lac z, lac a genlerinin transkripsiyonu gerçekleşir
(b) Baskılayıcı, operatöre bağlanamıyor
(c) Baskılayıcı, operatöre bağlanabilir
(d) Hem (a) hem de (b) doğrudur
Cevap:
(d) Hem (a) hem de (b) doğrudur

Soru 15.
Sebepler verin: Genetik kod 'evrensel'dir.
Cevap:
Genetik kod evrenseldir. Bu, bilinen tüm canlı sistemlerin nükleik asitleri kullandığı ve aynı üç baz kodonun (üçlü kodon) amino asitlerden protein sentezini yönlendirdiği anlamına gelir. Örneğin, mRNA (UUU) kodonu, tüm organizmaların tüm hücrelerinde fenilalanin için kodlar. Prokaryotik, mitokondriyal ve kloroplast genomlarında bazı istisnalar bildirilmiştir. Ancak benzerlikler farklılıklardan daha yaygındır.

Soru 16.
Verilen transkripsiyon biriminde 'A' ve 'B' olarak işaretlenen bölümleri adlandırın:
Cevap:

Soru 17.
– Öncü diziyi ve gecikmeli diziyi ayırt edin
Cevap:

  1. DNA polimeraz I İlgili DNA onarım mekanizması
  2. DNA polimeraz II İlgili DNA onarım mekanizması
  3. DNA polimeraz III DNA replikasyonunda yer alır

Soru 18.
– Şablon dizisini ve kodlama dizisini ayırt edin.
Cevap:

  1. Şablon Zinciri: Replikasyon sırasında, 3' → 5' polaritesine sahip DNA ipliği, şablon iplik olarak işlev görür.
  2. Kodlama Dizisi: Replikasyon sırasında 5' → 3' polaritesine sahip DNA dizisi kodlama dizisi görevi görür.

Soru 19.
İnsan genomunda tanımlanan tek nükleotid polimorfizminin (SNP'ler) biyolojik ve tıp biliminde devrim niteliğinde değişiklik getirebileceği iki yoldan bahsedin.
Cevap:
Bilim adamları, insanlarda tek baz DNA farklılıklarının (SNP'ler – Tek nükleotid polimorfizmi – 'snips' olarak telaffuz edilir) meydana geldiği yaklaşık 1,4 milyon konum belirlediler. 'SNIPS'in tanımlanması, hastalıkla ilişkili diziler için kromozomal konumların bulunmasında ve insanlık tarihinin izlenmesinde yardımcı olur.

Soru 20.
İnsan genom projesinin herhangi üç hedefini belirtin.
Cevap:

  1. İnsan DNA'sındaki tüm genleri (yaklaşık 30000) tanımlayın.
  2. İnsan DNA'sını oluşturan üç milyar kimyasal baz çiftinin sırasını belirleyin.
  3. Bu bilgileri veritabanlarında saklamak için.

Soru 21.
E.coli'de laktoz varlığında üç enzim 0-galaktosidaz, permeaz ve transasetilaz üretilir. Laktoz yokluğunda enzimlerin neden sentezlenmediğini açıklayın.
Cevap:
Laktoz yokluğunda, baskılayıcı protein operatöre bağlanır ve yapısal genin RNA polimeraz tarafından transkripsiyonunu engeller, dolayısıyla enzimler üretilmez. Bununla birlikte, laktoz yokluğunda bile her zaman minimum düzeyde lac operon ifadesi olacaktır.

22. soru
Yapısal gen, düzenleyici gen ve operatör geni arasında ayrım yapar.
Cevap:
Operonun yapısı: Her operon, bir gen ekspresyonu ve düzenleme birimidir ve bir veya daha fazla yapısal genden ve yapısal genin transkripsiyonel aktivitesini kontrol eden bitişik bir operatör geninden oluşur.

  1. Yapısal gen, hücrenin ihtiyaç duyduğu proteinler, rRNA ve tRNA'yı kodlar.
  2. Promotörler, RNA sentezini başlatan DNA'daki sinyal dizileridir. RNA polimeraz, transkripsiyonun başlamasından önce promotöre bağlanır.
  3. Operatörler, promotörler ve yapısal genler arasında bulunur. Baskılayıcı protein, operonun operatör bölgesine bağlanır.

23. soru
E-coli'de her zaman düşük düzeyde bir lac operon ekspresyonu meydana gelir. Açıklamayı gerekçelendirin.
Cevap:
Lak operon tarafından sentezlenen enzimlerden biri, laktozun hücrelere taşınmasında rol oynayan permeazdır. Lac operon inaktive olursa, permeaz sentezlenmez, dolayısıyla laktoz hücreye giremez. Laktoz, bir indükleyici görevi görür, baskılayıcı proteine ​​bağlanır ve gen ekspresyonunu başlatmak için operatörü açar.

Soru 24.
İnsan genom projesine neden mega proje deniyor?
Cevap:
Uluslararası insan genom projesi 1990 yılında başlatıldı. Bu mega bir projeydi ve tamamlanması 13 yıl sürdü. İnsan genomu, bugüne kadar dizilen herhangi bir organizmanın genomundan yaklaşık 25 kat daha büyüktür ve tamamlanan ilk omurgalı genomudur. İnsan genomunun yaklaşık 3 > 109 bp'ye sahip olduğu söylenmektedir. HGP, biyolojide biyoinformatik adı verilen yeni bir alanın hızlı gelişimi ile yakından ilişkiliydi.

25. soru
Watson ve Crick, DNA'nın yapısını incelemelerinden, olası DNA replikasyonu, kodlama yeteneği ve mutasyon mekanizması hakkında ne çıkardılar?
Cevap:
Watson ve Crick'in DNA replikasyonu üzerine çıkarımı: Bir sarmaldaki DNA zincirinin her birinin, DNA replikasyonu sırasında kalıp görevi gördüğü ve ebeveyn zincirini tamamlayıcı olan yeni yavru DNA moleküllerinin oluşumuna yol açtığı sonucuna varmışlardır (yani, Yarı-koruyucu yöntem. replikasyon) Kodlama kabiliyetine ilişkin çıkarım: Transkripsiyon sırasında, DNA zincirindeki genetik bilgi, tamamlayıcı bazlar olarak mRNA'ya kodlanır (RNA'da timin yerine urasil hariç) Mutasyona ilişkin çıkarım: DNA'nın nükleotid dizisindeki herhangi bir değişiklik, spesifik proteinin aminoasit dizisindeki karşılık gelen değişiklik, böylece genetik kodun geçerliliğini doğrular.

26. soru
Neden tRNA'ya adaptör molekül deniyor?
Cevap:
Bir hücrenin transfer RNA, (tRNA) molekülü, sitoplazma boyunca dağılmış amino asitleri toplayan ve ayrıca mRNA moleküllerinin spesifik kodlarını okuyan bir araç görevi görür. Bu nedenle adaptör molekül olarak adlandırılır. Bu terim Francis Crick tarafından ileri sürülmüştür.

27. soru
RNA ve DNA arasındaki üç yapısal fark nedir?
Cevap:
DNA:

  1. Şeker deoksiriboz şekerdir.
  2. Çift iplikli yapı.
  3. Azot bazları Adenin, Guanin, Sitozin ve Timindir.
  1. Şeker riboz şekeridir.
  2. Tek sarmallı molekül.
  3. Azot bazları Adenin, Guanin, Sitozin ve Urasil'dir.

28. soru
Aşağıdaki kodonları tanımak için gereken antikodonu adlandırın:
AAU, CGA, UAU ve GCA.
Cevap:
UUA, GCU, AUA ve CGU.

Soru 29.
(a) Aşağıda verilen şekli belirleyiniz
(b) Yapıyı çoğaltma çatalı olarak yeniden çizin ve parçaları etiketleyin
(c) Bu replikasyon için enerji kaynağını yazın ve bu süreçte yer alan enzimi adlandırın.
(d) İki şablon ipliğin polaritesine bağlı olarak protein sentezindeki farklılıklardan bahsedin.
Cevap:
(a) Çoğaltma çatalı
(B)

(c) Deoksi nükleotit, trifosfat replikasyon için bir enerji kaynağı görevi görür. DNA polimeraz replikasyon için kullanılır
(d) Protein sentezi için mRNA temas bilgileri, polaritesi 5' → 3' olan DNA zincirinden geliştirilecektir.

Soru 30.
Bir transkripsiyon birimindeki kodlama dizisi aşağıdaki gibi yazılırsa:
5' TGCATGCATGCATGCATGCATGCATGC 3'
mRNA dizisini yazın.
Cevap:
mRNA dizisi 3'ACGUACGUACGUUCGUACGUACGUACG5'

31. soru.
Protein sentezinin iki aşamalı süreci nasıl avantajlıdır?
Cevap:
Ökaryotik genlerin bölünmüş gen özelliği, prokaryotlarda neredeyse tamamen yoktur. Başlangıçta her ekson, belirli bir işleve sahip tek bir polipeptit zinciri için kodlanmış olabilir. Ekson düzenlemesi ve intron çıkarılması esnek olduğundan, bu polipeptit alt birimlerini kodlayan ekson, yeni genler oluşturmak için çeşitli şekillerde birleşen alanlar olarak işlev görür. Tek genler, hayvanlarda hem protein hem de fonksiyonel çeşitliliğin üretilmesinde önemli bir rol oynadığı bilinen bir mekanizma olan alternatif ekleme paternleri yoluyla eksonlarını birkaç farklı şekilde düzenleyerek farklı fonksiyonel proteinler üretebilir. İntronlar, ökaryotik genin evriminden önce veya sonra ortaya çıkmış olurdu.

İntronlar geç ortaya çıktıysa ökaryotik gene nasıl girdiler? İntronlar, kendilerini mobil transpozon benzeri elementler (organizmalar arasında gen transferine aracılık eden – Horizontal Gen Transfer – HGT) gibi davranan belirli 'hedef bölgelerin' dışında ve aynı zamanda bunlara ekleyebilen hareketli DNA dizileridir. HGT, prokaryotik hücrelerin soyları arasında veya prokaryotik hücrelerden ökaryotik hücrelere ve ökaryotik hücreler arasında meydana gelir. HGT'nin artık Dünya'daki yaşamın evriminde önemli bir rol oynadığı varsayılıyor.

32. soru.
Neden Hershey ve Chase sadece radyoaktif olarak işaretlenmiş fosfor ve kükürt kullandı? Radyoaktif olarak işaretlenmiş karbon ve nitrojen kullansalar aynı sonucu alırlar mıydı?
Cevap:
Genellikle proteinler kükürt içerir ancak fosfor içermez ve nükleik asit (DNA) , fosfor içerir ancak kükürt içermez. Bu nedenle Hershey – Chase, kültür ortamında viral protein ve nükleik asidin ayrı izini tutmak için kükürt (35 S) ve fosforun (32 P) radyoaktif izotoplarını kullandı. Radyoaktif karbon ve nitrojen kullanılırsa bu moleküller hem DNA'da hem de proteinlerde bulunduğundan beklenen sonuca ulaşılamaz.

33. soru
Nükleozom oluşumunu açıklayınız.
Cevap:
Komberg, nükleozom için, dört histon proteini H2A, H2B, H3 ve H4'ün 2 molekülünün, histon oktamer adı verilen sekiz molekülden oluşan bir birim oluşturacak şekilde düzenlendiği bir model önerdi.

Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir. Histon oktamerleri yakın temas halindedir ve DNA, nükleozomun dışına sarılmıştır.

Soru 34.
RNA'nın ilk genetik materyal olduğu tespit edilmiştir. Gerekçe vererek gerekçelendirin.
Cevap:
1980'lerin başında üç moleküler biyolog (Leslie Orgel, Francis Brick ve Carl Woese) bağımsız olarak, yaşamın evriminin ilk aşaması olarak 'RNA dünyasını' önerdiler; bu aşama, RNA'nın hayatta kalma ve replikasyon için gerekli tüm molekülleri katalize ettiği bir aşamaydı. İlk olarak 1986'da Walter Gilbert tarafından kullanılan 'RNA dünyası' terimi, RNA'nın dünyadaki ilk genetik olduğunu varsayıyor. Artık temel yaşam süreçlerinin (metabolizma, translasyon ve ekleme vb.) RNA etrafında geliştiğini öne sürmek için yeterli kanıt var. RNA, hem genetik materyal hem de katalizör görevi görme yeteneğine sahiptir. Canlı sistemlerde RNA tarafından katalize edilen birkaç biyokimyasal reaksiyon vardır. Bu katalitik RNA, ribozim olarak bilinir. Ancak, bir katalizör olan RNA reaktifti ve dolayısıyla kararsızdı.

Bu, belirli kimyasal modifikasyonlarla daha kararlı bir DNA formunun evrimine yol açtı. DNA, tamamlayıcı zincire sahip çift sarmallı bir molekül olduğundan, bir onarım süreci geliştirerek değişikliklere direnmiştir. Bazı RNA molekülleri, DNA'ya bağlanarak gen düzenleyicileri olarak işlev görür ve gen ekspresyonunu etkiler. Bazı virüsler genetik materyal olarak RNA kullanır. Andrew Fire ve Craig Mellow (2006 Nobel Ödülü sahipleri), RNA'nın yaşam kimyasında aktif bir bileşen olduğu görüşündeydiler.

Samacheer Kalvi 12. Biyo Zooloji Moleküler Genetik Ek Sorular ve Cevaplar

Soru 1.
'Gen' terimi ___________ tarafından icat edildi
Cevap:
Wilhelm Johannsen

Soru 2.
Sonunda kimin deneyi, DNA'nın genetik materyal olduğuna dair ikna edici kanıtlar sağladı?
(a) Griffith deneyi
(b) Avery, Macleod ve McCarty'nin deneyi
(c) Hershey-Chase deneyi
(d) Urey-Miller'in deneyi
Cevap:
(c) Hershey-Chase deneyi

Soru 3.
Hershey – Chase deneyinde, T 2 fazının DNA'sı ___________ kullanılarak radyoaktif hale getirildi.
(a) 32P
(b) 32 S
(c) 35P
(d) 32 S
Cevap:
(a) 32P

Soru 4.
Bir nükleosit ____________
(a) Şeker ve Fosfat
(b) Azot bazı ve Fosfat
(c) Şeker ve Azot bazı
(d) Şeker, Fosfat ve Azotlu baz
Cevap:
(c) Şeker ve Azot bazı

Soru 5.
Yanlış ifadeyi tanımlayın
(a) baz, H+ iyonu kabul eden bir maddedir.
(b) Hem DNA hem de RNA dört baza sahiptir.
(c) Pürinler tek karbon-azot halkasına sahiptir
(d) Timin DNA için benzersizdir
Cevap:
(c) Pürinler tek karbon-azot halkasına sahiptir

Soru 6.
Watson ve Crick, f __________ X-ışını kırınım analizine dayanan çift sarmal DNA modelini önerdiler.
(a) Erwin Chargaff
(b) Meselson ve Stahl
(c) Wilkins ve Franklin
(d) Griffith
Cevap:
(c) Wilkins ve Franklin

7. soru
'RNA dünyası' terimi ilk olarak ___________ tarafından kullanılmıştır.
Cevap:
Walter Gilbert

Soru 8.
DNA'da ardışık iki baz çifti arasındaki mesafe ____________
(a) 0.34 nm
(b) 3.4 nm
(c) 0.034 nm
(d) 34 nm
Cevap:
(a) 0.34 nm

Soru 9.
E. coli DNA'sının uzunluğu 1,36 mm ise baz çifti sayısı ____________
(a) 0.36 × 106 m
(b) 4 × 106 m
(c) 0.34 × 10 -9 nm
(d) 4 × 10 -9 m
Cevap:
(b) 4 × 106 m

Soru 10.
Ökaryotik kromozomun organizasyonunda uygun diziyi belirleyin.
(a) Nükleozom – Solenoid – Kromatit
(b) Kromatid – Nükleozom – Solenoidi
(c) Solenoid – kromatin – DNA
(d) Nükleozom – solenoid – genoforu
Cevap:
(a) Nükleozom – Solenoid – Kromatit

Soru 11.
İddia (A) : Prokaryotlarda genofor fark edilir.
Sebep (R) : Bakteriler, kromatin organizasyonu olmayan dairesel DNA'ya sahiptir.
(a) Hem A hem de R doğrudur
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(c) R, A'yı açıklar

Soru 12.
İddia (A): Heterokromatin transkripsiyonel olarak aktiftir.
Sebep (R): Koyu lekeli, sıkıca paketlenmiş kromatin.
(a) Hem A hem de R doğrudur
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(d) A yanlış, R doğru

Soru 13.
İddia (A) : Yarı-muhafazakar model Hershey ve Chase tarafından önerildi.
Sebep (R) : Kız DNA'sı sadece yeni iplikler içerir.
(a) Hem A hem de R yanlış
(b) A doğrudur R yanlıştır
(c) R, A'yı açıklar
(d) A yanlış, R doğru
Cevap:
(a) Hem A hem de R yanlış

Soru 14.
Komberg enzimi _____ olarak adlandırılır.
Cevap:
DNA polimeraz I

Soru 15.
DNA replikasyonu hücre döngüsünün __________ fazında gerçekleşir.
(NS
(b) S
(c)1
(d)2
Cevap:
(b) S

Soru 16.
Yarı muhafazakar çoğaltma modeli __________ tarafından kanıtlanmıştır.
(a) Hershey ve Chase
(b) Griffith
(c) Meselson ve Stahl
(d) Macleod ve McCarty
Cevap:
(c) Meselson ve Stahl

Soru 17.
Bir ökaryotik hücrede kaç çeşit DNA polimeraz bulunur?
(a) iki
(b) üç
(c) dört
(d) beş
Cevap:
(d) Beş

Soru 18.
Yanlış ifadeyi tanımlayın
(a) Replikasyon, DNA'nın ori – bölgesinde meydana gelir
(b) Deoksi nükleotid trifosfat bir substrat görevi görür
(c) DNA zincirinin çözülmesi topoizomeraz tarafından gerçekleştirilir
(d) DNA polimeraz 3-OH'de polimerizasyonu katalize eder
Cevap:
(c) DNA zincirinin çözülmesi topoizomeraz tarafından gerçekleştirilir

Soru 19.
Süreksiz olarak sentezlenen gecikmeli iplik parçalarına ________ denir.
Cevap:
Okazaki parçaları

Soru 20.
Retrovirüsler, genetik materyal olarak ________ sahiptir.
Cevap:
RNA

Soru 21.
Hangisi transkripsiyon ünitesinin bir parçası DEĞİLDİR?
(a) Destekleyici
(b) Operatör
(c) Yapısal gen
(d) Sonlandırıcı
Cevap:
(b) Operatör

22. soru
Goldberg – Hogness ökaryot kutusu, ________ prokaryota eşdeğerdir.
Cevap:
Pribnow kutusu

23. soru
Okazaki fragmanları, DNA replikasyonu sırasında ________ enzimi ile birleştirilir.
Cevap:
DNA ligazı

Soru 24.

Cevap:
(a) A – iv, B – i, C – ii, D – iii

25. soru
Prokaryotların RNA polimerazı, polimerizasyonu başlatmak için faktöre bağlanır.
(a) ro
(b) teta
(c) sigma
(d) psi
Cevap:
(c) sigma

26. soru

(a) Sınırlama
(b) Kuyruk
(c) Ekleme
(d) Transkripsiyon
Cevap:
(c) Ekleme

27. soru
Prokaryotlarda aşağıdaki özelliklerden hangisi yoktur?
(a) Prokaryotlar üç ana RNA tipine sahiptir
(b) Yapısal genler polisistroniktir
(c) Transkripsiyonun başlama süreci 'P' faktörünü gerektirir
(d) Bölünmüş gen özelliği
Cevap:
(d) Bölünmüş gen özelliği

28. soru
Aşağıdaki dizilerden hangisi tam olarak çevrilmiştir?
(i) AGA, UUU, UGU, AGÜ, UAG
(ii) AĞUSTOS, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AĞUSTOS,AAU,AAC,UAU,UAG
(a) ben ve ii
(b) sadece ii
(c) ben ve iii
(d) ii ve iv
Cevap:
(d) ii ve iv

Soru 29.
mRNA'nın kapatılması __________ kullanılarak gerçekleşir
(a) Poli A kalıntıları
(b) Metil guanozin trifosfat
(c) Deoksi ribonükleotit trifosfat
(d) Ribonükleotid trifosfat
Cevap:
(b) Metil guanozin trifosfat

Soru 30.
Bir yönü genetik kodun bir özelliği değil mi?
(a) Spesifik
(b) Dejenere
(c) Evrensel
(d) belirsiz
Cevap:
(d) belirsiz

31. soru.
Üçlü kodonlardan hangisi prolin kodu değildir?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) sadece ben
(b) ii ve iv
(c) sadece iii
(d) yukarıdakilerin tümü
Cevap:
(b) ii ve iv

32. soru.
Bölünmüş genlerde bulunan kodlama dizilerine denir.
(a) Operonlar
(b) İntronlar
(c) Eksonlar
(d) Sistron
Cevap:
(c) Eksonlar

33. soru
Aşağıdaki mRNA'lardan hangisi translasyondan sonra 6 aminoasit verir?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AUG UAC CAU UGC UGA UGC AGG AGC CCG
Cevap:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Soru 34.
Prokaryotlarda RNA polimeraz ile ilişkili transkripsiyon sonlandırma faktörü
(a) θ
(b) σ
(c) ρ
(d) ∑
Cevap:
(c) ρ

35. soru
Bir DNA çift sarmalında, guanin %30 ise, timinin yüzdesi ne olur?
(a) %100
(b) %20
(c) %10
(d) %70
Cevap:
(b) %20

36. soru
Tirozin için kodlayan üçlü çiftleri tanımlayın
(a) UUU,UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Cevap:
(b) UAU, UAU

37. soru.

Cevap:
A – ii B – i C – iv D – iii

Soru 38.
AUG kodu __________ içindir
(a) Arginin
(b) Tirozin
(c) Triptofan
(d) Metionin
Cevap:
(d) Metionin

Soru 39.
DNA'nın kodlama zincirindeki bazların dizisi G A G T A G C A G G C'dir, bu durumda birincil transkriptteki kodonların dizisi şöyledir:
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Cevap:
(b) C U C A A U C G U C C G

Soru 40.
Ökaryotun promotör bölgesi __________
(a) TATAA
(b) AĞUSTOS
(c) UUUGA
(d) AAAAU
Cevap:
(a) TATAA

41. soru
Aşağıdakileri eşleştirin:
(A) AĞUSTOS – (i) Tirozin
(B) UGA – (ii) Glisin
(C) UUU – (iii) Metionin
(D) GGG – (iv) Fenilalanin
(a) A – iii B – i C – iv D – ii
(b) A – iii B – ii C – i D – iv
(c) A – iv B – i C – iii D – ii
(d) A – ii B – i C – iv D – iii
Cevap:
(d) A – ii B – i C – iv D – iii

42. soru.
__________ kodon sayısı, sistin kodları.
Cevap:
2

43. soru.
Orak hücre anemisinde, β – globin geninin __________ kodonu değiştirilir.
(a) Sekizinci
(b) Yedinci
(c) Altıncı
(d) Dokuzuncu
Cevap:
(c) Altıncı

44. soru
Yanlış ifadeyi seçin.
(a) tRNA bir adaptör molekül gibi davranır
(b) Stop kodonlarında tRNA bulunmaz
(c) Aminoasidin eklenmesi tRNA'nın hidrolizine yol açar
(d) tRNA'nın dört ana döngüsü vardır
Cevap:
(c) Aminoasidin eklenmesi tRNA'nın hidrolizine yol açar

45. soru
Aşağıdaki antibiyotiklerden hangisi tRNA ile mRNA arasındaki etkileşimi inhibe eder?
(a) Neomisin
(b) Streptomisin
(c) Tetrasiklin
(d) Kloramfenikol
Cevap:
(a) Neomisin

47. soru.
İlgili işleve sahip gen kümesine _________ denir.
(a) Sistron
(b) Operon
(c) Muton
(d) Keşif
Cevap:
(b) Operon

48. soru.
Lac operonunun baskılayıcı proteini, operonun __________'sına bağlanır.
(a) Destekleyici bölge
(b) Operatör bölgesi
(c) sonlandırıcı bölge
(d) indükleyici bölge
Cevap:
(b) Operatör bölgesi

49. soru
__________ için Lac Z gen kodları
(a) Geçirgenlik
(b) transasetilaz
(c) β-galaktosidaz
(d) Aminoasil transferaz
Cevap:
(c) β-galaktosidaz

Soru 50.
Lac operon modeli __________ tarafından önerildi
Cevap:
Yakup ve Monod

51. soru
İnsan genomundaki yaklaşık baz çifti sayısı __________
Cevap:
3 × 10 9 bp

52. soru
Otomatik DNA dizileri tarafından geliştirilmiştir.
Cevap:
Frederick Sanger

53. soru
Hangi kromozomun gen yoğunluğu daha yüksektir?
(a) Kromozom 20
(b) Kromozom 19
(c) Kromozom 13
(d) Kromozom Y
Cevap:
(b) Kromozom 19

54. soru
Y kromozomunda bulunan gen sayısı __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Cevap:
(d) 231

55. soru
E.Coli'nin lac operonunda kaç tane yapısal gen bulunur?
(a) 4
(b) 3
(c) 2
(d) 1
Cevap:
(b) 3

56. soru
DNA parmak izi tekniği geliştirildi
(a) Yakup ve Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Cevap:
(b) Alec Jeffreys

57. soru
DNA parmak izinde, DNA parçalarının ayrılması __________ ile yapılır.
(a) Santrifüjleme
(b) Elektroforez
(c) X-ışını kırınımı
(d) denatürasyon
Cevap:
(b) Elektroforez

58. soru
SNP'nin kısaltması
(a) Tek nükleotid Polimorfizmi
(b) Tek Nükleozit Polipeptidi
(c) Tek nükleotid Polimorfizmi
(d) Tek nükleotid polimer
Cevap:
(a) Tek nükleotid Polimorfizmi

Soru 59.
Çeviri yapılmayan spesifik mRNA dizileri __________
Cevap:
Çevrilmemiş Bölgeler (UTR)

60. soru.
Kodlamayan veya araya giren DNA dizisine __________ denir.

Soru 61.
_______ İntron, DNA'nın monomeridir.
Cevap:
nükleotid

Soru 62.
Aşağıdakilerden hangisi yanlış eşleştirilmiştir?
(a) Transkripsiyon – DNA'dan RNA'ya bilgi kopyalama
(b) Çeviri – mRNA'dan proteine ​​bilgi çözme
(c) Replikasyon – DNA kopyalarının yapılması
(d) Eksonların intronlarla birleştirilmesi –
Cevap:
(d) Eksonların intronlarla birleştirilmesi –

Soru 1.
Bir gen – Bir enzim hipotezini kim önerdi? Tanımla.
Cevap:
George Beadle ve Edward Tatum, bir genin bir enzimin üretimini kontrol ettiğini belirten Bir gen – Bir enzim hipotezi önerdiler.

Soru 2.
Nükleosidi nükleotitten ayırt edin.
Cevap:

  1. Nükleozit: Nükleozit alt birimi, bir pentoz şeker molekülüne bağlı azotlu bazlardan oluşur.
  2. nükleotid: Nükleotid alt birimi, azotlu bazlardan, bir pentoz şekeri ve bir fosfat grubundan oluşur.

Soru 3.
DNA ve RNA arasındaki temel farkları belirtin.
Cevap:
DNA:

  1. DNA, deoksiriboz şekerinden yapılmıştır.
  2. DNA'nın azotlu bazları Adenin, Guanin, Sitozin ve Timin'dir.
  1. RNA riboz şekerinden yapılır.
  2. RNA'nın azotlu bazları Adenin, Guanin, Sitozin ve Urasil'dir.

Soru 4.
RNA'nın azotlu bazlarına dikkat edin.
Cevap:
Adenin, Guanin, Sitozin ve Urasil.

Soru 5.
DNA ve RNA'yı asidik moleküller yapan nedir?
Cevap:
Fosfat fonksiyonel grubu (PO4) DNA ve RNA'ya fizyolojik pH'ta bir asidin özelliğini verir, dolayısıyla nükleik asit adını verir.

Soru 6.
Hangi tür bağ oluşur

  1. pürin ve pirimidin bazı arasında?
  2. pentoz şekeri ve bitişik nükleotit arasında?
  1. Purin ve pirimidin bazları hidrojen bağları ile bağlanır.
  2. Pentoz şekeri, bitişik nükleotide fosfodiester bağları ile bağlanır.

7. soru
DNA, canlı organizmaların çoğu için RNA değil, genetik materyal görevi görür. İfadeyi desteklemek için nedenler belirtin.
Cevap:

  1. RNA reaktifti ve bu nedenle oldukça kararsızdı.
  2. Bazı RNA molekülleri, DNA'ya bağlanarak gen düzenleyicileri gibi davranır ve gen ekspresyonunu etkiler.
  3. RNA'nın urasili, DNA'nın timinden daha az kararlıdır.

Soru 8.
Genetik materyali RNA olan iki virüsü adlandırın.
Cevap:

Soru 9.
Bir molekülün genetik materyal olarak hareket etmesi için sahip olması gereken özellikler nelerdir?
Cevap:

  1. Kendini çoğaltma
  2. Bilgi depolama
  3. istikrar
  4. Mutasyon yoluyla varyasyon

Soru 10.
DNA sarmalının bir tam dönüşünde kaç baz çifti bulunur? Ardışık iki baz çifti arasındaki mesafe nedir?
Cevap:
İki bitişik baz çifti arasında 0.34 x 109m mesafe ile her dönüşte on baz çifti vardır.

Soru 11.
Genofor nedir?
Cevap:
E. coli gibi prokaryotlarda tanımlanmış bir çekirdeğe sahip olmasalar da, DNA hücrenin her tarafına dağılmamıştır. DNA (negatif yüklü), nükleoid adı verilen bir bölgede bazı proteinlerle (pozitif yükleri olan) tutulur. Bir nükleoid olarak DNA, protein tarafından tutulan büyük halkalar halinde düzenlenir. Prokaryotların DNA'sı neredeyse daireseldir ve kromatin organizasyonundan yoksundur, dolayısıyla genofor olarak adlandırılır.

Soru 12.
Nükleozom nedir? Tipik bir nükleozomda kaç baz çifti vardır?
Cevap:
Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir.

Soru 13.
NHC'yi genişletin ve tanımlayın
Cevap:

  1. NHC : Histon olmayan Kromozomal protein.
  2. Ökaryotlarda, histon proteinlerinin yanı sıra, kromatinin daha yüksek düzeyde paketlenmesi için ek protein setlerine ihtiyaç vardır ve bunlar histon olmayan kromozomal proteinler olarak adlandırılır.

Soru 14.
Heterokromatin ve Ökromatin arasında ayrım yapın.
Cevap:
heterokromatin:

  1. Kromatinin gevşek bir şekilde paketlendiği ve ışığı lekelediği çekirdek bölgesine Heterokromatin denir.
  2. Transkripsiyonel olarak etkin değil.
  1. Kromatinin sıkıca paketlendiği ve lekelerin koyu olduğu çekirdek bölgesine Ökromatin denir.
  2. Transkripsiyonel olarak aktif.

Soru 15.
Yaygın olarak kabul edilen DNA replikasyonu modeli hangisidir? Kim kanıtladı?
Cevap:
Yarı muhafazakar çoğaltma modeli. 1958 yılında Meselson ve Stahl tarafından kanıtlanmıştır.

Soru 16.
Adıyla anılan kimyasal maddeyi adlandırın

  1. DNA polimeraz I, Komberg enzimi olarak da bilinir.
  2. Polinükleotid fosforilaz, Ochoa enzimi olarak da bilinir.

Soru 17.
Çeşitli prokaryotik DNA polimeraz türlerini adlandırın. Çoğaltma sürecindeki rollerini belirtin.
Cevap:

  1. DNA Polimeraz I DNA onarım mekanizmasına dahil olur
  2. DNA Polimeraz II DNA onarım mekanizmasına dahil olur
  3. DNA Polimeraz III DNA replikasyonunda yer alır

Soru 18.
Deoksi nükleotid trifosfatın replikasyondaki işlevi nedir?
Cevap:
Deoksi nükleotit trifosfat, substrat görevi görür ve ayrıca polimerizasyon reaksiyonu için enerji sağlar.

Soru 19.
Aşağıda verilen bazı ökaryotik replikasyon olaylarıdır. İşlemde yer alan enzimleri adlandırın.

  1. DNA'nın çözülmesi
  2. Okazaki parçalarının birleştirilmesi
  3. Yeni zincire nükleotidlerin eklenmesi
  4. Onarımın düzeltilmesi

Soru 20.
Öndeki ipliği gecikmeli iplikten ayırt edin
Cevap:
önde gelen iplikçik:

Soru 21.
Okazaki parçaları nelerdir?
Cevap:
Gecikmeli ipliğin süreksiz olarak sentezlenen fragmanlarına, DNA ligaz enzimi ile birleştirilen Okazaki fragmanları denir.

22. soru
Çoğaltma çatalı nedir?
Cevap:
Replikasyonun başlangıç ​​noktasında, helikazlar ve topoizomerazlar (DNA giraz) çözülür ve iplikleri birbirinden ayırır, replikasyon çatalı adı verilen Y-şekilli bir yapı oluşturur. Her kaynakta iki çoğaltma çatalı vardır.

23. soru
DNA polimeraz dışında, ökaryotik hücrenin DNA replikasyonunda yer alan diğer dört enzimi adlandırın.
Cevap:
DNA ligaz, Topoizomeraz (DNA giraz), Helikaz ve Nükleaz.

Soru 24.
Merkezi dogmayı kim önerdi? Konseptini yazınız.
Cevap:
Francis Crick, moleküler biyolojide genetik bilginin aşağıdaki gibi aktığını belirten Merkezi dogmayı önerdi:

25. soru
Transkripsiyonu tanımlayın ve bu süreçte yer alan enzimi adlandırın.
Cevap:
Genetik bilginin bir DNA dizisinden RNA'ya kopyalanması işlemine transkripsiyon denir. Bu işlem, DNA'ya bağımlı RNA polimeraz varlığında gerçekleşir.

26. soru
TATA kutusu nedir? İşlevini belirtin.
Cevap:
Ökaryotlarda, promotör, TATA kutusu veya Goldberg-Hogness kutusu olarak adlandırılan zengin AT bölgelerine sahiptir. RNA polimeraz için bir bağlanma yeri görevi görür.

27. soru
Ökaryotların yapısal geni prokaryotlardan farklıdır. Nasıl?
Cevap:
Ökaryotlarda yapısal gen sadece bir proteini kodlayan monosistronik iken prokaryotlarda yapısal gen birçok proteini kodlayan polisistroniktir.

28. soru
Prokaryotik RNA polimerazın iki ana bileşeni nelerdir? Nasıl davranırlar?
Cevap:
Bakteriyel (prokaryotik) RNA polimeraz, çekirdek enzim ve sigma alt birimi olmak üzere iki ana bileşenden oluşur. Çekirdek enzim (β1, β ve α), RNA sentezinden ” sorumludur, oysa promotörün tanınmasından bir sigma alt birimi sorumludur.

Soru 29.
Eksonlar ve intronlar arasında ayrım yapın.
Cevap:

  1. Eksonlar: Bir ökaryotik genin eksprese edilmiş dizileri (Kodlama dizileri)
  2. İntronlar: Bir ökaryotik genin araya giren dizileri (kodlayıcı olmayan diziler)

Soru 30.
Eklemeyi tanımlayın.
Cevap:
İntronları hnRNA'dan çıkarma işlemine ekleme denir.

31. soru.
Kapatma ve kuyruklama nedir?
Cevap:
Alışılmadık bir nükleotidin kapatılmasında, hnRNA'nın 5' ucuna metil guanozin trifosfat eklenirken, kuyrukta 3' ucuna adenilat kalıntıları (200-300) (Poli A) eklenir.

32. soru.
Çift sarmallı bir DNA'da %20 sitozin varsa, DNA'daki adenin yüzdesini hesaplayın.
Cevap:
Sitdsine = 20, dolayısıyla Guanin = 20
ChargafFs kuralına göre (A+T) = (G+C) =100
Timin + Adenin Yüzdesi = 20 + 20 = 100
(T + A) = (20 + 20) =100
(T + A)=100-(20 + 20)
T +A = 100 – 40
T + A = 60
Bu nedenle Adenin yüzdesi 60/2 = %30 olacaktır.

33. soru
AUG'nin ikili işlevlerinden bahsedin.
Cevap:
AUG'nin çift işlevi vardır. Bir başlatıcı kodon görevi görür ve ayrıca metiyonin amino asidini kodlar.

Soru 34.
Translasyonun sonlandırılmasında kaç kodon yer alır. Onlara isim verin.
Cevap:
Üç kodon, çeviri sürecini sonlandırır. Bunlar UAA, UAG ve UGA'dır.

35. soru
Kodonun yozlaşması – yorumu.
Cevap:
Dejenere bir kod, birden fazla üçlü kodonun belirli bir amino asidi kodlayabileceği anlamına gelir. Örneğin, valin için kodonlar GUU, GUC, GUA ve GUG kodu.

36. soru
Genetik kodun evrenselliğine ilişkin istisnai kategorilere dikkat edin.
Cevap:
Genetik kodun evrensel doğasının istisnaları, prokaryotik mitokondriyal ve kloroplast genomlarında fark edilir.

37. soru.
Anlamsız kodonlar nelerdir?
Cevap:
UGA, UAA ve UAG, çeviriyi sonlandıran anlamsız kodonlardır.

Soru 38.
Kodlayan üçlü kodonları adlandırın

Soru 39.
Neden hnRNA'nın ekleme geçirmesi gerekiyor?
Cevap:
hnRNA hem kodlayıcı dizileri (eksonlar) hem de kodlamayan dizileri (intronlar) içerdiğinden, intronları çıkarmak için uçbirleştirmeye tabi tutulması gerekir.

Soru 40.
Aşağıdaki kodonların çeviri sürecindeki rolünü belirtiniz

41. soru
Aşağıda verilen mRNA dizisidir. Translasyonundan sonra oluşan aminoasit dizisinden bahsedin.
Cevap:
3'AUGAAGAUGGGUAA5'
Metionin – Lizin – Aspartik asit – Glisin

42. soru.
Valine kodlayan dört kodonu adlandırın.
Cevap:
GUU, GUC, GUA ve GUG.

43. soru.
DNA zincirlerinden birindeki baz dizisi TAGC ATGAT'dir. Tamamlayıcı dizisindeki baz dizisinden bahsedin.
Cevap:
Tamamlayıcı iplikte ATCGTACTA vardır.

44. soru
Neden t-RNA adaptör molekül olarak adlandırılıyor?
Cevap:
Bir hücrenin transfer RNA (tRNA) molekülü, sitoplazma boyunca dağılmış amino asitleri toplayan ve ayrıca mRNA moleküllerinin spesifik kodlarını okuyan bir araç görevi görür. Bu nedenle adaptör molekül olarak adlandırılır.

45. soru
tRNA'nın yüklenmesi ile ne demek istiyorsun? Bu süreçte yer alan enzimi adlandırın.
Cevap:
Amino asidin tRNA'ya eklenmesi işlemi, aminoasilasyon veya yükleme olarak bilinir ve elde edilen ürüne aminoasil-tRNA (yüklü tRNA) denir. Aminoasilasyon, bir aminoasil – tRNA sentetaz enzimi tarafından katalize edilir.

46. ​​soru.
UTR'ler nelerdir?
Cevap:
mRNA'nın ayrıca çevrilmemiş ve Çevrilmemiş Bölgeler (UTR) olarak adlandırılan bazı ek dizileri vardır. UTR'ler hem 5' ucunda (başlangıç ​​kodonundan önce) hem de 3' ucunda (durdurma kodonundan sonra) bulunur.

47. soru.
S – D dizisi nedir?
Cevap:
Prokaryotların mRNA'sının 5' ucu, mRNA'nın ilk AUG başlangıç ​​kodonundan önce gelen özel bir diziye sahiptir. Bu ribozom bağlanma bölgesi Shine – Dalgamo dizisi veya S-D dizisi olarak adlandırılır. Bu diziler, başlatmayı kolaylaştıran küçük ribozomal alt birimin 16Sr RNA'sının bir bölgesi ile baz çiftleri oluşturur.

48. soru.
Çeviri birimini tanımlayın.
Cevap:
mRNA'daki bir çeviri birimi, 5' ucunda başlangıç ​​kodonu ve 3' ucunda durdurma kodonu ve polipeptit kodlarıyla çevrili RNA dizisidir.

49. soru
Bakteri translasyonunda tetrasiklin ve streptomisinin inhibitör rolünden bahsedin.
Cevap:
Tetrasiklin, aminoasil tRNA ve mRNA arasındaki bağlanmayı engeller. Streptomisin, translasyonun başlamasını engeller ve yanlış okumaya neden olur.

Soru 50.
Gen ifadesi hangi aşamada düzenlenir?
Cevap:
Gen ifadesi, transkripsiyonel veya translasyonel seviyelerde kontrol edilebilir veya düzenlenebilir.

51. soru
operon nedir? Örnek ver.
Cevap:
İlgili işlevlere sahip gen kümesine operon denir.
Örn: E.coli'de lac operon.

52. soru
E.coli'nin lac operonunu dikkate alarak aşağıdaki genlerin ürünlerini adlandırın.

  1. gen – baskılayıcı protein
  2. lac Z geni – fS-galaktosidaz
  3. Lac Y geni – Geçirgenlik
  4. lac a gen – transasetilaz

54. soru
sahip olan insan kromozomunu adlandırın.

  1. Kromozom 1 maksimum sayıda gen içerir (2968 gen)
  2. Y kromozomu en az gene sahiptir (231 gen)

55. soru
SNP'ler nelerdir? Kullanımlarından bahsedin.
Cevap:
SNP'ler : Tek nükleotid polimorfizmi. Hastalıkla ilişkili diziler için kromozomal konumların bulunmasına ve insanlık tarihinin izlenmesine yardımcı olur.

56. soru
DNA parmak izinin kullanılabileceği dört alandan bahsedin.
Cevap:

  1. Adli analiz
  2. soy analizi
  3. Yaban hayatının korunması
  4. antropolojik çalışmalar

57. soru
Nükleik asitleri şeker moleküllerine göre sınıflandırır.
Cevap:
Pentoz şekerinin türüne bağlı olarak iki tür nükleik asit vardır. Deoksiriboz şeker içerenlere Deoksiribo Nükleik Asit (DNA), riboz şeker içerenlere Ribonükleik Asit (RNA) denir. Bu iki şeker arasındaki tek fark, deoksiribozda bir oksijen atomunun eksik olmasıdır.

58. soru
Hem pürinler hem de pirimidinler azot bazlarıdır, ancak farklıdırlar. Nasıl?
Cevap:
Hem pürinler hem de pirimidinler azot bazlarıdır. Pürin bazları Adenin ve Guanin çift karbonlu nitrojen halkasına sahipken, sitozin ve timin bazları tek karbonlu nitrojen halkasına sahiptir.

Soru 59.
5' DNA'sı 3'ünden ne kadar farklıdır?
Cevap:
DNA'nın 5', fosfat (P04V) fonksiyonel grubunun eklendiği şekerdeki karbonu belirtir. DNA'nın 3', bir hidroksil (OH) grubunun eklendiği şekerdeki karbonu belirtir.

60. soru.
Eyalet Chargaff kuralı.
Cevap:
Erwin Chargaff'a göre,

  1. Adenin, Timin ile iki hidrojen bağı ile eşleşir.
  2. Guanin, üç hidrojen bağı ile Sitozin ile eşleşir.

Soru 61.
Kimyasal olarak DNA, RNA'dan daha kararlıdır – Justify.
Cevap:
DNA'da tamamlayıcı olan iki iplik, ısıtılarak ayrılırsa (denatüre edilirse) uygun koşul sağlandığında bir araya gelebilir (renatürasyon). RNA'daki her nükleotitte bulunan diğer 2 OH grubu, RNA'yı sorumlu ve kolayca bozunabilir yapan reaktif bir gruptur. RNA'nın katalitik ve reaktif olduğu da bilinmektedir. Bu nedenle, DNA, RNA ile karşılaştırıldığında kimyasal olarak daha kararlı ve kimyasal olarak daha az reaktiftir. DNA'da urasil yerine timinin varlığı, DNA'ya ek stabilite sağlar.

Soru 62.
Yarı muhafazakar DNA replikasyonu modu hakkında basit bir şekilde yazın.
Cevap:
Yarı-koruyucu replikasyon 1953'te Watson ve Crick tarafından önerildi. Bu replikasyon mekanizması DNA modeline dayanmaktadır. DNA molekülünün iki polinükleotid zincirinin gevşeyip bir uçtan ayrılmaya başladığını öne sürdüler. Bu işlem sırasında kovalent hidrojen bağları kırılır. Ayrılan tek iplik daha sonra yeni bir ipliğin sentezi için şablon görevi görür. Daha sonra, her bir kız çift sarmal, ana molekülden bir şablon görevi gören bir polinükleotit zinciri taşır ve diğer zincir yeni sentezlenir ve ana sarmalın tamamlayıcısıdır.

Soru 63.
Basitleştirilmiş bir nükleozom diyagramı çizin ve etiketleyin.
Cevap:

64. soru.
astar nedir?
Cevap:
Bir primer, kısa bir RNA dizisidir. Yeni iplik oluşumunu başlatır. Primer, yeni bir iplik oluşturmak için deoksiribonükleotitlerin eklendiği ribonükleotid dizisinde 3'-OH ucu üretir.

65. soru.
Her iki DNA dizisi de transkripsiyon sırasında kopyalanmaz. Sebep ver.
Cevap:
DNA'nın her iki ipliği de iki nedenden dolayı transkripsiyon sırasında kopyalanmaz.

  1. Her iki iplik de bir şablon görevi görürse, farklı dizilere sahip RNA'yı kodlarlar. Bu da farklı amino asit dizilerine sahip proteinleri kodlayacaktır. Bu, iki farklı proteini kodlayan bir DNA parçası ile sonuçlanacak ve dolayısıyla genetik bilgi transfer makinesini karmaşıklaştıracaktır.
  2. Aynı anda iki RNA molekülü üretilseydi, birbirini tamamlayan çift sarmallı RNA oluşacaktı. Bu, RNA'nın proteinlere çevrilmesini önleyecektir.

Soru 66.
Bir şablon dizisi ve kodlama dizisi ile ne demek istiyorsunuz?
Cevap:
DNA'ya bağımlı RNA polimeraz, polimerizasyonu sadece bir yönde katalize eder, 3'→ 5' polaritesine sahip iplik, kalıp görevi görür ve kalıp iplik olarak adlandırılır. 5'→ 3' polaritesine sahip olan diğer iplik, RNA ile aynı diziye sahiptir (urasil yerine timin hariç) ve transkripsiyon sırasında yer değiştirir. Bu diziye kodlama dizisi denir.

67. soru.
Prokaryotlarda transkripsiyonun başlamasından ve sona ermesinden sorumlu olan faktörleri adlandırın.
Cevap:

  1. Sigma faktörü, transkripsiyonun başlatılmasından sorumludur.
  2. Rho faktörü, transkripsiyonun sonlandırılmasından sorumludur.

Soru 68.
Prokaryotların başlıca RNA türlerini adlandırın ve rollerinden bahsedin.
Cevap:
Prokaryotlarda üç ana RNA türü vardır: mRNA, tRNA ve rRNA. Bir hücrede bir proteini sentezlemek için her üç RNA'ya da ihtiyaç vardır. mRNA şablonu sağlar, tRNA amino asitleri getirir ve genetik kodu okur ve rRNA'lar yapısal ve katalitik rol oynar.
çeviri sırasında.

Soru 69.
Genetik kodu tanımlayın.
Cevap:
DNA molekülü boyunca baz çiftlerinin sırası, bir organizmanın proteinlerinde bulunan amino asitlerin türünü ve sırasını kontrol eder. Baz çiftlerinin bu özel düzenine genetik kod denir.

70. soru
Wobble hipotezini açıklayın.
Cevap:
Wobble Hipotezi Crick (1966) tarafından tRNA antikodonunun mRNA kodonunun tamamlayıcı olmayan bazıyla bile eşleşerek 5' ucunda yalpalama yeteneğine sahip olduğunu ileri sürmüştür. üçüncü baz tamamlayıcı olmayabilir.

Kodonun üçüncü tabanına yalpalama tabanı ve bu pozisyona yalpalama pozisyonu denir. Gerçek baz eşleşmesi yalnızca ilk iki konumda gerçekleşir. Wobbling hipotezinin önemi, polipeptit sentezi için gerekli tRNA'ların sayısını azaltması ve kod dejenerasyonunun etkisinin üstesinden gelmesidir.

71. soru
Ökaryotik ribozomun doğasını açıklar.
Cevap:
Ökaryotların (80 S) ribozomları daha büyüktür ve 60 S ve 40 S alt birimlerinden oluşur. 'S', Svedberg birimi (S) olarak ifade edilen sedimantasyon verimini belirtir. Ökaryotlardaki daha büyük alt birim, 23 S RNA ve 5Sr RNA molekülü ve 31 ribozomal proteinden oluşur. Daha küçük ökaryotik alt birim, 18Sr RNA bileşeninden ve yaklaşık 33 proteinden oluşur.

72. soru.
ORF'yi genişletin ve tanımlayın.
Cevap:
Bir başlangıç ​​kodonu ile başlayan ve bir proteine ​​çevrilebilen herhangi bir DNA veya RNA dizisi, Açık Okuma Çerçevesi (ORF) olarak bilinir.

Soru 73.
Prokaryotik çevirinin başlama kompleksinin bileşenleri nelerdir?
Cevap:
E. coli'de translasyonun başlatılması, ribozomun 30S alt birimlerinden, bir haberci RNA'dan ve yüklü N-formil metionin tRNA'dan (f met -1 RNA f met ), üç proteinli başlatma faktöründen oluşan bir başlatma kompleksinin oluşumu ile başlar. (IF 1, IF2, IF3), GTP (Guaniner Tri Fosfat) ve Mg 2+.

Soru 74.
Operonun bileşenlerini açıklar.
Cevap:
Operonun yapısı: Her operon, bir gen ekspresyonu ve düzenleme birimidir ve aşağıdakilerden oluşur:
bir veya daha fazla yapısal genin ve transkripsiyonel kontrol eden bitişik bir operatör genin
yapısal genin aktivitesi.

  1. Yapısal gen, hücrenin ihtiyaç duyduğu proteinler, rRNA ve tRNA'yı kodlar.
  2. Promotörler, RNA sentezini başlatan DNA'daki sinyal dizileridir. RNA polimeraz I, transkripsiyonun başlamasından önce promotöre bağlanır.
  3. Operatörler, promotörler ve yapısal genler arasında bulunur. Baskılayıcı protein, operonun operatör bölgesine bağlanır.

75. soru.
Hershey ve Chase deneyini açıklayın. Onların deneyi ne sonuca varıyor?
Cevap:
Alfred Hershey ve Martha Chase (1952), bakterileri enfekte eden bakteriyofajlar üzerinde deneyler yaptılar. Faj T2 Escherichia coli bakterisini enfekte eden bir virüstür. Bakterilere fajlar (virüs) eklendiğinde, dış yüzeye adsorbe olurlar, bazı materyaller bakteriye girer ve daha sonra her bakteri çok sayıda soy fajını serbest bırakmak için parçalanır. Hershey ve Chase, bakterilere girenin DNA mı yoksa protein mi olduğunu gözlemlemek istediler. Tüm nükleik asitler fosfor içerir ve kükürt içerir (sistein ve metionin amino asidinde). Hershey ve Chase, enfeksiyon sürecinde viral protein ve nükleik asitlerin ayrı izini tutmak için Kükürt (35 S) ve fosforun (32 P) radyoaktif izotoplarını kullanan bir deney tasarladı.

Fajların, 35 S veya 32 P radyoaktif izotoplarını içeren kültür ortamında bakterileri enfekte etmesine izin verildi. 35 S varlığında gelişen bakteriyofaj, etiketli proteinlere ve32P varlığında büyüyen bakteriyofajlar, etiketli DNA'ya sahipti. Böylece farklı etiketleme, fajın DNA'sını ve proteinlerini tanımlamalarını sağladı. Hershey ve Chase, etiketli fajları etiketlenmemiş E. coli ile karıştırdı ve bakteriyofajların genetik materyallerine saldırmasına ve enjekte etmesine izin verdi. Enfeksiyondan kısa bir süre sonra (bakterilerin parçalanmasından önce), bakteri hücreleri, yapışan faz partiküllerini gevşetmek için bir karıştırıcıda hafifçe çalkalandı.

Bakteri hücreleriyle ilişkili sadece 32P'nin bulunduğu ve bakteri hücrelerinde değil, çevreleyen ortamda 35S'nin bulunduğu gözlendi. Faj soyu radyoaktivite açısından incelendiğinde, 35 S değil, sadece 32 P taşıdığı bulundu. Bu sonuçlar, bakteri hücrelerine protein kaplamanın değil, sadece DNA'nın girdiğini açıkça göstermektedir. Böylece Hershey ve Chase, virüsten bakterilere kalıtsal bilgiyi taşıyanın protein değil, DNA olduğunu kesin olarak kanıtladılar.

Soru 76.
DNA'yı ideal bir genetik materyal yapan özelliklerini açıklayın.
Cevap:
1. Kendini Çoğaltma: Çoğaltabilmeli. Baz eşleşmesi ve tamamlayıcılık kuralına göre, her iki nükleik asit (DNA ve RNA) duplikasyonları yönlendirme yeteneğine sahiptir. Proteinler bu kriteri karşılayamaz.

2. Kararlılık: Yapısal ve kimyasal olarak kararlı olmalıdır. Genetik materyal, yaşam döngüsünün farklı evreleri, yaş veya organizmanın fizyolojisindeki değişikliklerle değişmeyecek kadar kararlı olmalıdır. Genetik materyalin özelliklerinden biri olarak kararlılık, Griffith'in dönüştürme ilkesinde açıkça görülüyordu. Bakterileri öldüren ısı, genetik materyalin bazı özelliklerini yok etmedi. DNA'da iki iplik birbirini tamamlayıcıdır.

ısıtılarak ayrılırsa (denatüre edilirse) uygun koşul sağlandığında bir araya gelebilir (renatürasyon). RNA'daki her nükleotitte bulunan daha fazla 2' OH grubu, RNA'yı sorumlu ve kolayca bozunabilir yapan reaktif bir gruptur. RNA'nın katalitik ve reaktif olduğu da bilinmektedir. Bu nedenle, DNA, RNA ile karşılaştırıldığında kimyasal olarak daha kararlı ve kimyasal olarak daha az reaktiftir. DNA'da urasil yerine timinin varlığı, DNA'ya ek stabilite sağlar.

3. Bilgi saklama: Mendel karakterleri şeklinde kendini ifade edebilmelidir. RNA, protein sentezini doğrudan kodlayabilir ve karakterleri kolayca ifade edebilir. Ancak DNA, proteinlerin sentezi için RNA'ya bağlıdır. Hem DNA hem de RNA genetik bir materyal gibi davranabilir, ancak DNA'nın daha kararlı olması genetik bilgiyi depolar ve RNA genetik bilgiyi aktarır.

4. Mutasyon yoluyla varyasyon: Mutasyona uğrayabilmeli. Hem DNA hem de RNA mutasyona uğrayabilir. RNA kararsız olduğundan daha hızlı mutasyona uğrar. Böylece daha kısa ömürlü RNA genomuna sahip virüsler daha hızlı mutasyona uğrayabilir ve evrimleşebilir. Yukarıdaki tartışma, hem RNA'nın hem de DNA'nın bir genetik materyal olarak işlev görebileceğini gösterir. DNA daha kararlıdır ve genetik bilginin depolanması için tercih edilir.

Soru 77.
DNA ökaryotik bir hücrede nasıl paketlenir? ft
Cevap:
Ökaryotlarda organizasyon daha karmaşıktır. Kromatin, nükleozom adı verilen bir dizi tekrar eden birimlerden oluşur. Komberg, nükleozom için, dört histon proteini H2A, H2B, H3 ve H4'ün 2 molekülünün, histon oktamer adı verilen sekiz molekülden oluşan bir birim oluşturacak şekilde düzenlendiği bir model önerdi. Negatif yüklü DNA, nükleozom adı verilen bir yapı oluşturmak için pozitif yüklü histon oktamerin etrafına sarılır. Tipik bir nükleozom, 200 bp DNA sarmalı içerir. Histon oktamerleri yakın temas halindedir ve DNA, nükleozomun dışına sarılmıştır. Komşu nükleozomlar, enzimlere maruz kalan bağlayıcı DNA (HI) ile bağlanır.

DNA, histon oktamerleri etrafında iki tam dönüş yapar ve iki dönüş bir HI molekülü tarafından kapatılır. HI içermeyen kromatin, DNA'nın nükleozomları rastgele yerlerde araya girip bıraktığı bir ip üzerinde boncuk görünümüne sahiptir. Bir nükleozomun HI'sı, komşu nükleozomların 33l'si ile etkileşime girerek fiberin daha fazla katlanmasına neden olabilir.

İnterfaz çekirdeklerindeki ve mitotik kromozomlardaki chrof&atin lifi 200-300 nm arasında değişen çapa sahiptir ve inaktif kromatini temsil eder. 30 nm fiber, nucfeosbme zincirlerinin, dönüş başına altı nükleozom içeren bir solenoid yapıya katlanmasından doğar. Bu yapı, farklı HI molekülleri arasındaki etkileşim ile stabilize edilir. DNA bir solenoiddir ve yaklaşık,%)_kat paketlenmiştir. Kromozom yapısının hiyerarşik doğası gösterilmektedir.

Kromatinin daha yüksek seviyede paketlenmesi için ek ptein seti gereklidir ve bunlar histon olmayan kromozomal proteinler (NHC) olarak adlandırılır. Tipik bir çekirdekte*, kromatinin bazı bölgeleri İbose olarak paketlenir (hafif lekeli) ve ökromatin olarak adlandırılır. Sıkıca paketlenmiş (koyu lekeli) olan kromatine heterokromatin denir. Ökromatin transkripsiyonel olarak aktiftir ve heterokromatin transkripsiyonel olarak aktif değildir.

Soru 78.
Meselson ve Stahl'ın deneyi, DNA replikasyonunun yarı-kopyalama modunu kanıtladı. Açıklamak.
Cevap:
DNA replikasyonu modu 1958'de Meselson ve Stahl tarafından belirlendi. Yarı muhafazakar, muhafazakar ve dağınık çoğaltmaları ayırt etmek için bir deney tasarladılar. Deneylerinde, birçok nesil için ayrı ortamlarda iki E.coli kültürü yetiştirdiler. 'Ağır' kültür, nitrojen kaynağının (NH4CI) 15 N ağır izotopu içerdiği bir ortamda ve 'hafif' kültür, nitrojen kaynağının birçok nesiller için hafif izotop 14H içerdiği bir ortamda büyütüldü. Büyümenin sonunda, ağır kültürdeki bakteri DNA'sının sadece 15 N ve hafif kültürde sadece 14 N içerdiğini gözlemlediler. Ağır DNA, Sezyum adı verilen bir teknikle hafif DNA'dan (14 N'den 15 N) ayırt edilebildi. Klorür (CsCl) yoğunluk gradyanlı santrifüjleme. Bu süreçte, otuz iki kültürdeki hücrelerden ekstrakte edilen ağır ve hafif DNA, iki ayrı ve ayrı banda (hibrit DNA) yerleşir.

Ağır kültür (15 N) daha sonra sadece NH4CI içeren bir ortama aktarıldı ve çeşitli belirli zaman aralıklarında (20 dakika süre ile) numuneler aldı. İlk replikasyondan sonra DNA'yı çıkardılar ve yoğunluk gradyanlı santrifüjlemeye tabi tuttular. DNA, önceden belirlenmiş ağır ve hafif bantlar arasında orta konumda olan bir banda yerleşti. İkinci replikasyondan (40 dakika süre) sonra tekrar DNA örnekleri çıkardılar ve bu sefer DNA'nın biri hafif bant pozisyonunda diğeri ara pozisyonda olmak üzere iki banda yerleştiğini buldular. Bu sonuçlar Watson ve Crick'in yarı muhafazakar çoğaltma hipotezini doğrulamaktadır.

Soru 79.
Bir transkripsiyon biriminin ayrıntılı bir hesabını verin.
Cevap:
DNA'daki bir transkripsiyonel birim, bir promotör, yapısal gen ve bir terminatör olmak üzere üç bölge ile tanımlanır. Destekleyici 5 'ucuna doğru yer almaktadır. RNA polimeraz için bağlanma yeri sağlayan bir DNA dizisidir. Bir transkripsiyon ünitesinde promotörün varlığı, şablonu ve kodlama şeritlerini tanımlar. Kodlama zincirinin 3' ucuna doğru yer alan sonlandırıcı bölge, RNA polimerazın transkripsiyonu durdurmasına neden olan bir DNA dizisi içerir. Ökaryotlarda promotör, TATA kutusu (Goldberg-Hogness kutusu) ‘ adı verilen AT bakımından zengin bölgelere sahiptir ve prokaryotlarda bu bölgeye Pribnow kutusu denir.

Destekleyicinin yanı sıra ökaryotlar ayrıca bir geliştiriciye ihtiyaç duyar. Bir transkripsiyon ünitesinin yapısal genindeki DNA'nın iki ipliği zıt kutuplara sahiptir. DNA'ya bağımlı RNA polimeraz, polimerizasyonu sadece bir yönde katalize eder, 3'→5' polaritesine sahip iplik bir şablon görevi görür ve şablon iplik olarak adlandırılır. 5'→ 3' polaritesine sahip olan diğer iplik, RNA ile aynı diziye sahiptir (urasil yerine timin hariç) ve transkripsiyon sırasında yer değiştirir. Bu diziye kodlama dizisi denir.

Yapısal gen, monosistronik (ökaryotlar) veya polisistronik (prokaryotlar) olabilir. Ökaryotlarda, her mRNA yalnızca tek bir gen taşır ve yalnızca tek bir protein için bilgi kodlar ve monosistronik mRNA olarak adlandırılır. Prokaryotlarda, operon olarak bilinen, genellikle kromozom üzerinde yan yana bulunan ilgili gen kümeleri, tek bir mRNA vermek üzere birlikte kopyalanır ve bu nedenle polisistroniktir.

80. soru.
Prokaryotlarda transkripsiyon sürecini gerekli diyagramlarla açıklar.
Cevap:
Prokaryotlarda üç ana RNA türü vardır:
mRNA, tRNA ve rRNA'dır. Bir hücrede bir proteini sentezlemek için üç RNA'nın hepsine ihtiyaç vardır. mRNA şablonu sağlar, tRNA amino asitleri getirir ve genetik kodu okur ve rRNA'lar çeviri sırasında yapısal ve katalitik rol oynar. Her tür RNA'nın transkripsiyonunu katalize eden tek bir DNA'ya bağımlı RNA polimeraz vardır. Promotöre bağlanır ve transkripsiyonu başlatır (Başlatma).

Polimeraz bağlanma bölgelerine promotör denir. Substrat olarak nükleosit trifosfat ve tamamlayıcılık kuralına göre şablona bağlı bir şekilde polimerazlar kullanır. Transkripsiyonun başlamasından sonra, polimeraz, büyüyen RNA zincirine birbiri ardına bir nükleotid ekleyerek RNA'yı uzatmaya devam eder. Sadece kısa bir RNA parçası enzime bağlı kalır, polimeraz bir genin sonunda bir terminatöre ulaştığında, yeni oluşan RNA düşer, dolayısıyla RNA polimeraz da düşer. RNA polimeraz sadece uzama sürecini katalize etme yeteneğine sahiptir. RNA polimeraz, sırasıyla transkripsiyonu başlatmak ve sonlandırmak için başlatma faktörü sigma (a) ve sonlandırma faktörü rho (p) ile geçici olarak birleşir.

RNA'nın bu faktörlerle ilişkisi, RNA polimerazına transkripsiyon sürecini başlatması veya sonlandırması talimatını verir. Bakterilerde, mRNA'nın aktif hale gelmesi için herhangi bir işlem gerektirmediğinden ve ayrıca bakterilerde sitozol ve çekirdeğin ayrılması olmadığından transkripsiyon ve translasyon aynı anda aynı bölmede gerçekleştiğinden), çoğu kez çeviri mRNA'nın çok daha önce başlayabilir. tamamen transkripsiyonu. Bunun nedeni, genetik materyalin bir nükleer zar ile diğer hücre organellerinden ayrılmamış olmasıdır, dolayısıyla bakterilerde transkripsiyon ve translasyon birleştirilebilir.

81. soru
Genetik kodun belirgin özelliklerini yazınız.
Cevap:
Genetik kodun göze çarpan özellikleri aşağıdaki gibidir:

  1. Genetik kodon üçlü bir koddur ve 61 kodon amino asit kodudur ve 3 kodon herhangi bir amino asidi kodlamaz ve durdurma kodonu (Sonlandırma) olarak işlev görür.
  2. Genetik kod evrenseldir. Bu, bilinen tüm canlı sistemlerin nükleik asitleri kullandığı ve aynı üç baz kodonun (üçlü kodon) amino asitlerden protein sentezini yönlendirdiği anlamına gelir. Örneğin, mRNA (UUU) kodonu, tüm organizmaların tüm hücrelerinde fenilalanin için kodlar. Prokaryotik, mitokondriyal ve kloroplast genomlarında bazı istisnalar bildirilmiştir. Ancak benzerlikler farklılıklardan daha yaygındır.
  3. Örtüşmeyen bir kodon, aynı harfin iki farklı kodon için kullanılmadığı anlamına gelir. Örneğin, GUTJ ve GUC nükleotid dizisi sadece iki kodonu temsil eder.
  4. Virgülden daha azdır, bu da mesajın bir uçtan diğerine doğrudan okunacağı anlamına gelir, yani iki kod arasında noktalama işaretine gerek yoktur.
  5. Dejenere bir kod, birden fazla üçlü kodonun belirli bir amino asidi kodlayabileceği anlamına gelir. Örneğin, valin için kodonlar GUU, GUC, GUA ve GUG kodu.
  6. Belirsiz olmayan kod, bir kodonun bir amino asidi kodlayacağı anlamına gelir.
  7. Kod her zaman sabit bir yönde, yani polarite adı verilen 5'→3' yönünden okunur.
  8. AUG'nin çift işlevi vardır. Bir başlatıcı kodon görevi görür ve ayrıca metiyonin amino asidini kodlar.
  9. UAA, UAG (tirozin) ve UGA (triptofan) kodonları, sonlandırma (durdurma) kodonları olarak adlandırılır ve aynı zamanda “anlamsız” kodonlar olarak bilinir.

Soru 82.
Genetik koddaki mutasyonlar fenotipi etkiler. Örnekle açıklayın.
Cevap:
Moleküler düzeydeki en basit mutasyon türü, nükleotidde bir bazın diğeriyle yer değiştirdiği bir değişikliktir.Bu tür değişiklikler, kendiliğinden veya mutajenlerin etkisinden dolayı meydana gelebilen baz ikameleri olarak bilinir. İyi çalışılmış bir örnek, insanlarda β-hemoglobin geninin (βHb) bir alelinin nokta mutasyonundan kaynaklanan orak hücreli anemidir.

Bir hemoglobin molekülü, ikisi a zinciri ve ikisi P zinciri olmak üzere iki tipte dört polipeptit zincirinden oluşur. Her zincirin yüzeyinde bir hem grubu vardır. Hem grupları oksijenin bağlanmasında rol oynar. Jruman kan hastalığı, orak hücreli anemi anormal hemoglobinden kaynaklanır. Hemoglobindeki bu anormallik, hemoglobinin p-zincirinde GAG'dan GTG'ye beta globingenin altıncı kodonundaki tek bir baz ikamesinden kaynaklanır.

P zincirinin 6. pozisyonunda amino asit glufeniik asidin valine değişmesiyle sonuçlanır. Bu, amino asit kalıntısı glutamik asidin valine dönüşmesiyle sonuçlanan nokta mutasyonunun klasik örneğidir. Mutant hemoglobin, oksijen gerilimi altında polimerizasyona uğrayarak RBC'nin şeklinin bikonkavdan orak şekilli bir yapıya dönüşmesine neden olur.

Soru 83.
E-coli'nin AteArperon mekanizmasını açıklayın.
Cevap:
Lac (Laktoz) operonu: E.coli'deki laktoz metabolizması, üç enzim – permeaz, P-galaktosidaz (P-gat) ve transasetilaz gerektirir. Laktozun hücreye girişi için permeaz enzimi gereklidir, Pjgglactosidase laktozun glikoz ve galaktoza hidrolizini sağlarken, transasety g asetil grubunu asetil Co A'dan P-galaktosidaza aktarır. Lac operon, tek düzenleyici genden (T geni inhibitör anlamına gelir) promotör sitelerinden (p) ve operatör bölgesinden (o) oluşur. Bunların yanı sıra lac z, y ve lac a olmak üzere üç yapısal geni vardır. lac 'z' geni P-gaiaqtttsidase için, lac 'y' geni permeaz için ve 'a' geni transasetilaz için kodlar.

Jacob ve Monod, E.coli'deki gen ekspresyonunu ve regülasyonunu açıklamak için klasik Lac operon modelini önerdiler. Lac'ta bir polisistronik yapısal gen, ortak bir promotör ve düzenleyici genfc tarafından düzenlenir. Hücre normal enerji kaynağını glikoz olarak kullandığında, "i" geni bir baskılayıcı mRNA'yı kopyalar ve translasyonundan sonra bir baskılayıcı protein üretilir. Operonun operatör bölgesine bağlanır ve translasyonu önler, bunun sonucunda P-galaktosidaz üretilmez. Glikoz gibi tercih edilen karbon kaynağının yokluğunda, bakteri için bir enerji kaynağı olarak laktoz mevcutsa, laktoz hücreye permeaz enzimi sonucu girer. Laktoz bir indükleyici görevi görür ve onu etkisiz hale getirmek için baskılayıcı ile etkileşime girer.

Baskılayıcı protein, operonun operatörüne bağlanır ve RNA polimerazın operonu kopyalamasını engeller. Laktoz veya allolaktoz gibi indükleyicinin mevcudiyetinde, represör indükleyici ile etkileşim yoluyla etkisiz hale getirilir. Bu, RNA polimerazın promotor bölgeye bağlanmasına ve laktoz metabolizması için gerekli tüm gerekli enzimlerin oluşumunu sağlayan lac mRNA'yı üretmek için operonu kopyalamasına izin verir. Lac operonunun baskılayıcı tarafından düzenlenmesi, transkripsiyon başlangıcının negatif kontrolünün bir örneğidir.

Soru 84.
İnsan Genom projesinin amaçları nelerdir?
Cevap:
İnsan Genom Projesinin ana hedefleri aşağıdaki gibidir:

  1. İnsan DNA'sındaki tüm genleri (yaklaşık 30000) tanımlayın.
  2. İnsan DNA'sını oluşturan üç milyar kimyasal baz çiftinin sırasını belirleyin.
  3. Bu bilgileri veritabanlarında saklamak için.
  4. Veri analizi için araçları geliştirin.
  5. İlgili teknolojileri endüstriler gibi diğer sektörlere aktarın.
  6. Projeden doğabilecek etik, yasal ve sosyal sorunları (ELSI) ele alın.

85. soru
İnsan Genom Projesinin göze çarpan özelliklerini yazınız.
Cevap:

  1. İnsan genomu 3 milyar nükleotid bazı içermesine rağmen, proteinleri kodlayan DNA dizileri genomun sadece %5'ini oluşturur.
  2. Ortalama bir gen 3000 bazdan oluşur, bilinen en büyük insan geni 2.4 milyon baz ile distrofindir.
  3. Genomun %50'sinin işlevi, LINE ve ALU dizisi gibi yer değiştirebilir elemanlardan türetilir.
  4. Genler 24 kromozom üzerinde dağıtılır. Kromozom 19, en yüksek gen yoğunluğuna sahiptir. Kromozom 13 ve Y kromozomu en düşük gen yoğunluğuna sahiptir.
  5. İnsan genlerinin kromozomal organizasyonu çeşitlilik gösterir.
  6. Genomda 35000-40000 gen olabilir ve neredeyse 99.9 nükleotid bazı tüm insanlarda tamamen aynıdır.
  7. Keşfedilen genlerin yüzde 50'sinden fazlasının işlevleri bilinmiyor.
  8. Proteinler için genom kodlarının yüzde 2'sinden azı.
  9. Tekrarlanan diziler, insan genomunun çok büyük bir bölümünü oluşturur. Tekrarlayan dizilerin doğrudan kodlama işlevi yoktur ancak kromozom yapısı, dinamikleri ve evrimine (genetik çeşitlilik) ışık tutarlar.
  10. Kromozom 1'de 2968 gen bulunurken, 'Y' kromozomunda 231 gen bulunur.
  11. Bilim adamları, insanlarda tek baz DNA farklılıklarının (SNP'ler – Tek nükleotid polimorfizm – 'kesintiler' olarak telaffuz edilir) meydana geldiği yaklaşık 1,4 milyon konum belirlediler. 'SNIPS'in tanımlanması, hastalıkla ilişkili diziler için kromozomal konumların bulunmasında ve insanlık tarihinin izlenmesinde yardımcı olur.

Soru 86.
DNA parmak izi tekniğinde yer alan prensibi açıklayın.
Cevap:
DNA parmak izi tekniği ilk olarak 1985 yılında Alec Jeffreys tarafından geliştirilmiştir. Bir kişinin DNA'sı ve parmak izleri benzersizdir. 1.5 milyon çift gen içeren 23 çift insan kromozomu vardır. Genlerin, nükleotid dizilimlerinde farklılık gösteren DNA parçaları olduğu iyi bilinen bir gerçektir. DNA'nın tüm segmentleri proteinler için kod oluşturmaz, bazı DNA segmentleri düzenleyici bir işleve sahipken, diğerleri araya giren dizilerdir (intronlar) ve yine diğerleri tekrarlanan DNA dizileridir. DNA parmak izinde, kısa tekrarlayan nükleotid dizileri kişiye özeldir. Bu nükleotid dizileri, değişken sayılı tandem tekrarları (VNTR) olarak adlandırılır. İki kişinin VNTR'leri genellikle çeşitlilik gösterir ve genetik belirteçler olarak faydalıdır.

DNA parmak izi, DNA dizisindeki tekrarlayan DNA adı verilen bazı spesifik bölgelerdeki farklılıkları tanımlamayı içerir, çünkü bu dizilerde küçük bir DNA dizisi birçok kez tekrarlanır. Bu tekrarlayan DNA, yoğunluk gradyanlı santrifüjleme sırasında farklı tepe noktaları olarak toplu genomik DNA'dan ayrılır. Toplu DNA büyük bir tepe noktası oluşturur ve diğer küçük tepe noktaları uydu DNA olarak adlandırılır. Baz bileşimine (A: T bakımından zengin veya G: C bakımından zengin), segmentin uzunluğuna ve tekrarlayan birimlerin sayısına bağlı olarak, uydu DNA'sı, mikro uydular ve mini uydular vb. gibi birçok alt kategoride sınıflandırılır.

Bu diziler herhangi bir proteini kodlamaz, ancak insan genomunun büyük bir bölümünü oluştururlar. Bu diziler yüksek derecede polimorfizm gösterir ve DNA parmak izinin temelini oluşturur. Bir suç mahallinde bırakılan kan, saç, deri hücreleri veya diğer genetik kanıtlardan izole edilen DNA, suçlu veya masum olup olmadığını belirlemek için suçlu bir şüphelinin DNA'sı ile VNTR kalıpları aracılığıyla karşılaştırılabilir. VNTR kalıpları, delil olarak bulunan DNA'dan veya vücudun kendisinden bir cinayet kurbanının kimliğini belirlemede de yararlıdır.

Soru 87.
DNA parmak izi tekniğinin adımlarını gösteren bir akış şeması çizin
Cevap:

Üst Düzey Düşünme Becerileri (HOT) Soruları

Soru 1.
Bir mRNA zinciri, ilk üç kodonu aşağıda verilen bir dizi üçlü kodona sahiptir.
(a) AĞUSTOS
(b) UUU
(c) UGC
(i) Bu üçlü kodonlar tarafından kodlanan amino asidi adlandırın.
(ii) Bu üçlü kodonların kopyalanacağı DNA dizisinden bahseder misiniz?
Cevap:
(i) Metionin için AUG kodları
Fenilalanin için UUU kodları
Sistein için UGC kodları
(ii) DNA'nın TAC dizisi AUG'ye kopyalanır
AAA DNA dizisi UUU'ya kopyalanır
ACG DNA dizisi UGC'ye kopyalanır

Soru 2.
Aşağıda, translasyon sürecinde yer alan tRNA moleküllerinin yapıları verilmiştir. Bir tRNA'da kodondan bahsedilir ancak amino asitten bahsedilmez. Başka bir tRNA molekülünde kodon değil amino asit adlandırılır. İlgili amino asitleri ve kodonları belirterek şekli tamamlayın.
Cevap:

Soru 3.
Bir DNA parçası, 32 adenin bazına ve 32 sitozin bazına sahiptir. Bu DNA parçası toplam kaç nükleotid içerir? Açıklamak.
Cevap:
128 nükleotid. Adenin her zaman Timin bazını eşleştirir. 32 adenin bazı varsa, o zaman 32 Timin bazı olmalıdır. Benzer şekilde sitozin guanin ile eşleşir. Sitozin bazlarının sayısı 32 ise, guanin bazları sitozin'e eşit olacaktır. Böylece toplam 128 nükleotit yapar.

Soru 4.
Aşağıda, bu A türevi kullanılarak TAC TCG CCC TAT UAA CCC AAA ACC TCT geninin bir bölümünü temsil eden bir DNA dizisi verilmiştir.

  1. RNA transkripti
  2. Eklenmiş mRNA (iki Aderine bazlı tüm kodonların intron olduğunu düşünün)
  3. mRNA tarafından kodlanan aminoasitlerin toplam sayısı
  1. RNA transkripti: AUG UGC GGG AUA GGG UUU UGG AGA
  2. Eklenmiş mRNA : AUG UGC GGG GGG UUU UGG
  3. 6 aminoasit mRNA tarafından kodlanır

Soru 5.
Moleküler süreçleri isimlendirerek tamamlayın

Samacheer Kalvi 12. Bio Zoology Chapter Wise Solutions PDF, tüm şüphelerinizi gidermenize yardımcı olacaktır. Samacheer Kalvi 12. Bölüm 5 Moleküler Genetik Soruları ve Cevapları Bio Zoology Solutions PDF'yi kullanarak mükemmel bir şekilde öğrenin. Sorularınızı gidermek için bize bir yorum bırakın. Sitemizi yer imlerine ekleyerek anında güncellemeler alın. Etkili ve mükemmel adım adım Samacheer Kalvi 12th Bio Zoology Guide ile en iyi öğrenimi elde edin.


Proteinler fosfor içerir mi? Eğer bu doğruysa, o zaman alfred hershey ve martha Chase proteinlerin fosfor içermediği ifadesini nasıl kullanmıştır? - Biyoloji

178 not kartı = 45 sayfa (sayfa başına 4 kart)

Satıyor ve Jeans Finali

1.) Doğadaki tüm moleküller arasında, nükleik asitler kendi replikasyonlarını yönetme yetenekleri bakımından benzersizdir. DNA'nın hangi özelliği/özellikleri onun bu olağandışı özelliğe sahip olmasına neden olur?

Bir dizide bulunan bilgi diğerindekiyle aynıdır.

2.) Tipik bir çift sarmallı DNA molekülündeki iki DNA zinciri hakkında aşağıdakilerden hangisi doğru bir ifadedir.

NS. İki iplik birbirine antiparalel olacaktır (bir ipliğin 5' ucu diğerinin 3' ucu ile eşleşecektir).

3.) Her nükleotid, iki sabit kısımdan (bir fosfat grubu ve bir pentoz şeker) ve bir değişken azotlu bazdan oluşur. Aşağıdakilerden hangisi RNA ile DNA arasındaki farklardan biri değildir?

e. Nükleotidler, RNA'nın 5' ucuna ve DNA moleküllerinin 3' ucuna eklenir.

4.) DNA polimerazlar hem hızları hem de doğrulukları açısından dikkate değer enzimlerdir. Büyüyen bir polinükleotit zincirine bir DNA polimeraz tarafından eklenen bir nükleotit düşünün. Halihazırda mevcut olan nükleotidin riboz şekeri üzerinde hangi konuma bir fosfodiester bağı yapılır?

5.) Bir organizmanın her bir hücresindeki DNA içeriğinin toplamı genellikle organizmanın "C-değeri" olarak adlandırılır. C-değerinin organizma karmaşıklığıyla orantılı bir şekilde arttığını varsaymak mantıklıdır. Aşağıdaki organizmalardan hangisinin en küçük C-değerine sahip olma olasılığı en yüksektir?

6.) Orak hücre anemisi olan kişiler, hastalığı olmayan kişilere göre -globin proteinlerinin amino asit dizisinde tek bir farka sahiptir. Bir ikame olan spesifik mutasyon, aynı zamanda, bir kısıtlama enziminin, etkilenen bireylerde belirli bir DNA fragmanı oluşturmada başarısız olmasına neden oldu. Neydi o mutasyon?

C. -globin proteininde altıncı amino asit olarak glutamik asit yerine valinin dahil edilmesiyle sonuçlanan bir değişiklik.

7.) DNA moleküllerinde sadece dört farklı nükleotid olmasına rağmen, hücreler tarafından protein yapımında kullanılan 20 farklı amino asidin sırasını belirtmek için bulundukları özel sıra kullanılır. 64 olası üçlü koddan kaç tanesi durdurma kodonu olarak kullanılmak üzere ayrılmıştır?

8.) Buğday genomu, insan genomundan yaklaşık beş kat daha büyüktür. Daha fazla protein kodlama bölgesi (gen) de içerebilir. İnsanlar nasıl oluyor da buğdaydan çok daha farklı proteinler üretebiliyor?

B. İnsanlar buğdaydan çok daha fazla alternatif ekleme yapıyor.

9.) Griffith, düz koloniler oluşturan Streptococcus pnemoniae'nin fareleri öldürebildiğini, ancak kaba kolonilerden gelen bakterilerin öldüremediğini buldu. Farelere sadece düz bakterilerin DNA'sını bulaştırmış olsaydı ne bulurdu?

Fareler hasta olmayacaktı.

10.) Alfred Hershey ve Martha Chase'in fosfor (32P) ve kükürtün (35S) radyoaktif izotoplarıyla radyoetiketledikleri virüsler T2 bakteriyofajdı. T2 virüsleri, enfeksiyon döngüsünün ilk aşaması olarak konakçı hücrelerinin genomik DNA'sını yok eden T4 virüsleri gibi, bir elektron mikroskobu ile bakıldığında dış görünüşü gibi ayrıntılı, "ay-iner" bir görünüme sahiptir. Birçok virüsün daha az ayrıntılı dış kaplamaları vardır, ancak bunların tümü hangi biyo-polimerden yapılmıştır?

11.) Meselson ve Stahl, iki farklı nitrojen izotopunu (15N ve 14N) kullanarak Watson ve Crick'in DNA replikasyonunun yarı-koruyucu bir süreçle meydana geldiğine dair tahminini test eden bir deney tasarladılar. DNA replikasyonu gerçekten muhafazakar olsaydı, bir tur hücre bölünmesinden sonra ne bulurlardı?

NS. Bazı çift sarmallı DNA molekülleri sadece 15N içerirken diğerleri sadece 14N içerir.

12.) DNA tipik olarak hücrelerde iki polinükleotid dizisinden oluşan bir çift sarmal olarak bulunur. Bir DNA molekülünün bir sarmalındaki bilgi, tamamlayıcı sarmalındaki bilgiyle neden gereksizdir?

C. Bir iplikteki her A ve G için diğerinde bir T ve C vardır.

13.) İnsan kromozomu 21'in (en küçüklerinden biri) haritalanması, 70.000'den fazla YAC klonunu taramak ve tüm kromozomu kapsayan örtüşen bir klon dizisi veren toplam 810 YAC'yi tanımlamak için kullanılan 198 STS'yi gerektirdi. Bu tür bir haritalama için plazmitler gibi bakteriyel vektörlerdeki klonlardan ziyade maya yapay kromozomu (YAC) klonlarını kullanmak neden daha uygundur?

NS. YAC'lerdeki klonlanmış bölgeler, bakteri klonlarında bulunanlardan çok daha büyük olabilir, bu nedenle kromozom yürüyüşlerinde daha az "adım" atılması gerekir.

14.) Genel bir kural olarak ökaryotlar, prokaryotlardan daha karmaşıktır. Prokaryotlar ve ökaryotlar arasındaki aşağıdaki farklılıklardan hangisi ökaryotik RNA polimerazlarının ve promotörlerinin prokaryotik karşılıklarından önemli ölçüde daha karmaşık olmasını gerektirir?

B. Ökaryotlar, gen ekspresyonunun dokuya özgü düzenlemesini başarmak zorundadır.

15.) Bir DNA zincirinin azotlu bazları 5' - TACGAA - 3' sırasına göre düzenlenmişse, tamamlayıcı zincirindeki nükleotidlerin sırası ne olur?

16.) Hekimlerin hastalarının tam genom diziliminden elde edilen bilgileri rutin olarak kullanması çok uzun sürmeyecektir. Bu bilgi, yasaklanmış ilaçların, mümkün olan en küçük doz ve yan etkilerle maksimum etkiyi sağlayacak şekilde belirli metabolizmaya göre ayarlanmasına izin vermelidir. Bu tür kişiselleştirilmiş tıbbın adı nedir?

17.) Mayoz bölünmenin I. fazı sırasında her insan kromozomunun uzunluğu boyunca ortalama üç ila dört kiazma görülebilir. Bazı bölgelerin kiazma oluşturma olasılığı diğerlerinden daha az görünmektedir. Bunun, bu bölgelerdeki rekombinasyon frekansına dayalı gen haritalama çalışmaları üzerinde ne etkisi olabilir?

e. Birbirine nispeten yakın görünen genler, gerçekten uzaktan bağlantılı olabilir.

Hücreler yeni proteinleri çevirdikçe, uygun amino asitler, karakteristik bir haç biçiminde (yonca yaprağı) ikincil yapıya sahip bir RNA molekülü tarafından ribozomlara taşınır. Bu RNA molekülü ailesinin üyelerine ne denir?

Proteinler asla doğrudan DNA içinde depolanan bilgilerden yapılmaz. Bunun yerine bilgi, RNA polimeraz tarafından bir RNA ara ürününe kopyalanır. Bu RNA ara ürünlerinin adı nedir?

Hücrelerde bulunan birçok RNA molekülü türünden hangisi, bir modifikasyonun varlığından dolayı ribozomlar tarafından özel olarak tanınır (bir “başlık”ın eklenmesi – olağandışı bir 5'-to-5' tri-fosfat bağlantısıyla tek bir guanin) 5' ucunda mı?

Prokaryotlardan farklı olarak ökaryotlar, genlerinin RNA transkriptlerini kapsamlı bir şekilde değiştirir. Bu işlem tamamlanmadan önce çağrılan proteinlere translasyon için hedeflenen ökaryotik RNA'lar nelerdir (yani, intronları henüz eklenmedi veya henüz poliadenile edilmedi).

. hnRNA'lar (heterojen RNA'lar).

22.) Thomas Hunt Morgan, Drosophila ile yaptığı çalışmalarda kalıtsal özelliklerin (genlerin) kromozomlarla ilişkili olduğunu ilk fark eden kişiydi. Drosophila'nın kromozomlardan çok daha fazla sayıda özelliğe sahip olduğu gerçeğini nasıl uzlaştırabildi?

C. Dört kromozomun her birinde birçok özelliğin kodlandığını buldu.

23.) George Beadle ve Edward Tatum, pembe ekmek kalıbının genetik materyalini değiştirmek için X-ışınlarını kullandılar. Küflerin büyümek için ihtiyaç duyduğu malzemeleri sentezleme yeteneğinin sonraki testleri, belirli genlerin değişmesinin aynı zamanda belirli enzimleri de değiştirdiğini ortaya çıkardı. Bu gözlemler, onlara 1958'de Nobel ödülü kazandıran bir teorinin temeliydi. O teori neydi?

C. Bir organizmadaki her bir enzim için bir gen vardı.

24.) Moleküler biyolojinin temel dogması nedir?

Bilgi DNA'dan RNA'ya ve proteine ​​geçer.

25.) Hem prokaryotlarda hem de ökaryotlarda tüm yeni proteinlere dahil edilen ilk amino asit metionindir. İki araştırmacı, prokaryotik ribozomların, translasyonu başlatmak için 5'-UAAGGAGG-3' (onların onuruna Shine-Delgarno dizisi olarak adlandırılmıştır) dizisini 5' bir başlangıç ​​kodonuna ihtiyaç duyduğunu buldu. Ribozomların bir mRNA salmasına ve büyüyen bir polipeptide amino asit eklemeyi bırakmasına neden olan nedir?

C. Ribozomlar, yüklü tRNA'ları olmayan bir kodonla karşılaştığında, mRNA'ları çevirmeyi durdururlar.

26.) Jacob ve Monod, kısmi diploidler ve lac operon ile yaptıkları çalışmalardan dolayı 1961'de Nobel ödülü kazandılar. Bir prokaryotik hücre, lacI geninin mutant (işlevsiz) bir versiyonuna, ancak lacZ geninin normal bir kopyasına sahip olsaydı, laktozun varlığına ve yokluğuna nasıl tepki verirdi?

e. Hem laktoz varken hem de yokken beta galaktosidaz yapar.

27.) Kısa adı IPTG olan bir kimyasal, lak baskılayıcıya bağlanmak için laktoza yeterince benzer, ancak -galaktosidaz enzimi tarafından parçalanamaz. IPTG'nin varlığının lac operon'un ifadesi üzerinde ne etkisi olabilir?

a. Laktoz olmadığında bile lac operon yüksek seviyelerde ifade edilir.

28.) lacI geninin protein ürünü için bağlanma bölgesi normalde tüm E. coli genomunda yalnızca bir kez bulunur – lac operon operatörü. Moleküler biyologlar, bir E. coli genomunu, trp operonunun promotörünün 50 nükleotid yukarısındaki bu bağlanma bölgesinin nükleotit dizisini içerecek şekilde genetik olarak tasarlasaydı ne olurdu?

a. trp operonunun ifadesi üzerinde hiçbir etkisi olmayacaktır.

Farklı Hfr suşları, bakteriyel kromozomlarının farklı kökenleri ve transfer yönleri sergiler. Beş farklı Hfr suşunun orijine (O) yakın genlerin transfer sırası aşağıda verilmiştir:

Hfr suşu/genlerin transfer sırası

Aşağıdakilerden hangisi bir E. coli kromozomunun doğru eşlenik haritasının bir parçasıdır?

30.) F faktörleri, prokaryotlarda bulunan birçok farklı türde plazmitten (ekstra kromozomal DNA parçaları) biridir. Tipik bir F faktörü kodunun 25 geninin çoğu, bakteri cinsiyeti için temel olarak önemli olan hangi dış yapı için geçerlidir?

31.) Laktoz operonunun hemen yukarı akışındaki bir gen tarafından kodlanan bir proteinin, beta-galaktosidaz geninin önündeki promotöre spesifik olarak bağlandığı, ancak sadece laktoz bulunmadığı zaman bulunduğu bulundu. Bu protein bağlandığında, RNA polimeraz bağlanamadı ve laktoz operonunun transkripsiyonunu başlatamadı. Bu protein hangi tür gen ekspresyonunun düzenlenmesinde rol oynar?

32.) Çoğu biyolojik yol, bir başlangıç ​​materyalinin bir son ürüne verimli bir şekilde dönüştürülmesi için hücrelerin iki veya daha fazla farklı enzime eşit miktarlarda sahip olmasını gerektirir. Prokaryotların hangi özelliği, bu tür yollarda genlerin koordineli ifadesini sağlamaya yardımcı olur?

B. İlgili işlevlere sahip genler genellikle tek bir operonda bulunur.

33.) Aşağıdakilerden hangisi E. coli'nin tek kromozomu ile insan hücrelerinin çok sayıda kromozomu arasındaki önemli bir fark değildir?

NS. E. coli'nin kromozomu, genlerinin kodlama bölgelerini kesintiye uğratan uzun kodlamayan dizi bölgelerine sahiptir.

34.) DNA ökaryotik hücrelerden izole edildiğinde, genellikle histon adı verilen yüksek oranda pozitif yüklü proteinlerin büyük bir miktarı ile sıkı bir şekilde ilişkili olduğu bulunur. Histonların çok çeşitli ökaryotik organizmalarda hemen hemen aynı olması, işlevlerinin kritik derecede önemli olması gerektiğini ima eder. Ökaryotik çekirdeklerde bulunan histon ve DNA kompleksine ne ad verilir?

35.) Laktoz intoleransı olan insanlar artık lac operondaki beta galaktosidaza eşdeğer enzimi yapmazlar. Prokaryotik bir hücrenin lac operonundaki aşağıdaki mutasyonlardan hangisi onun beta galaktosidaz sentezlemesine engel olabilir?

Başlangıç ​​kodonunun silinmesi.

36.) Geleneksel olarak, bir RNA polimeraz tarafından bir mRNA'ya dahil edilen ilk nükleotidin, o gen için "+1" pozisyonu olduğu söylenir. Prokaryotlarda, RNA polimerazın bağlanması ve doğru bir şekilde yönlendirilmesi için, bu pozisyonun yukarı akışında nispeten iyi korunmuş iki nükleotit dizisi 35 ve 10 baz çifti (bp) gereklidir. Bu Pribnow ve TATA kutuları ne kadar büyük?

37.) İnsan genomunun tam nükleotid dizisini elde eden moleküler biyologlar tarafından dört farklı fakat tamamlayıcı yaklaşım kullanıldı. Bu yaklaşımlar şunlardır: bağlantı haritalama, fiziksel haritalama, sıralama ve karşılaştırmalı dizi analizi. Bağlantı ve fiziksel haritalama nasıl farklıdır?

a. Sırasıyla ailelerin ve klon parçalarının analizlerini kullanırlar.

38.) Sir Alec Jefferies, ökaryotik mRNA'ların uzunluğunun, mRNA'ları genomik DNA'ya hibridize ettiğinde ve ürünlere bir elektron mikroskobu ile baktığında, aslında onları kodlayan genlerden çok daha kısa olduğunu gerçekten gören ilk kişiydi. Ökaryotik genlerin birincil transkriptlerinden birleştirilen kodlama bölümleri nelerdir?

39.) Tavuk ovalbümin geni, yalnızca tavuk yumurta kanalı hücrelerinde eksprese edilir. Aşağıdakilerden hangisinin doğru olma olasılığı yüksektir?

a. Çoğu dokuda heterokromatinde, ancak yumurta kanalı hücrelerinde ökromatinde olacaktır.

40.) Pek çok ökaryotik genom, kodlanmayan veya fazlalık DNA'nın çok geniş yollarını içerir. Bitkiler, evrimsel tarihleri ​​boyunca sık sık tüm genomlarının sayısız kopyasını biriktirmiş gibi görünüyor. Kopyası asıl amacına hizmet ettiği için işlevine artık ihtiyaç duyulmayan bir gene ne olur?

C. Bazıları, seçici bir avantaj sağlayan ve işlevsel kısıtlamaya giren yeni işlevler edinir.

41.) Edward Southern, kağıt benzeri zarlara bağlı DNA moleküllerinin, radyo-etiketli diğer serbest yüzen DNA molekülleri ile spesifik olarak hibritleşebileceğini gösteren ilk kişiydi. Southern'in tekniği DNA'nın aşağıdaki önemli özelliklerinden hangisine dayanmaktadır?

C. Tek sarmallı DNA'nın tamamlayıcı sarmalları birbirine afiniteye sahiptir.

42.) Translasyon başladığında, ribozomlar mRNA molekülleri boyunca üç nükleotid adımında hareket etmeye özen gösterirler. Ribozomlar bu okuma çerçevesini dikkate almazsa ne olur?

NS. Çerçeve kaymasının aşağısındaki amino asitler yanlış olacaktır.

43.) Kromozomlarımızın DNA'sında nükleotidlerin ortaya çıkma sırasını belirleme yeteneği, genetik kodumuzu doğrudan incelememize izin verdiği için, biyoloji çalışmasında açıkça büyük bir ilerlemeydi. Kullanılacak ilk DNA dizileme yöntemi, Maxam ve Gilbert'e Nobel Ödülü kazandırdı ve Sanger, kabaca on yıl sonra yeni bir yöntem geliştirene kadar yaygın olarak kullanıldı. Maxam ve Gilbert'in ve Sanger'ın yöntemleri nasıl farklıdır?

C. Birincisi, DNA'nın kimyasal bozulmasını içerirken, Sanger enzimatik bir işlemdir.

44.) DNA'nın agaroz jel elektroforezi, dikdörtgen bir agaroz levhasının (sert, jelatin benzeri bir malzeme) gözenekleri boyunca bir elektrik alanında DNA'nın hareketini içerir. DNA belirgin bir negatif yüke sahip olduğundan, jele bir elektrik akımı uygulandığında doğal olarak pozitif elektrotlara doğru hareket eder. Böyle bir sistemde büyük DNA parçaları küçük parçalara göre nasıl hareket eder?

a. Jel matrisi ile daha fazla karıştıkları için daha yavaştır.

45.) 1974'te prokaryotlarda DNA zincirlerini çok özel nükleotid dizilerinde kıran bir grup enzimin keşfinin, DNA'yı hem klonlama hem de dizileme ile ilgilenen araştırmacılar için paha biçilmez olduğu kanıtlandı. DNA'yı 5'-GGATCC-3' olarak adlandırılan dizide parçalayan BamHI gibi enzimler nelerdir?

46.) 1997 yılında kendi meme bezi hücrelerinden birinden Dolly adlı bir koyunun klonlanması, moleküler biyoloji için birçok yeni fırsatı mümkün kıldı. Aşağıdakilerden hangisi bir insan klonu için doğru değildir?

B. “Ebeveyni” ile aynı anılara sahip olacaktı.

47.) Aşağıdakilerden hangisi nesneleri artan büyüklük sırasına göre sıralar?

NS. Amino asitler, tRNA, mRNA, ribozomlar.

48.) Şeker hastaları, hayatta kalmak için genellikle insülin hormonunun düzenli dozlarına ihtiyaç duyarlar. Aşağıdakilerden hangisi, bu tür tedaviler için insülin sağlayabilecek bir transgenik organizma yapmanın makul bir yolunu temsil eder?

e. İnsan insülin proteini için DNA dizisinin önüne bir bakteriyel promotör koymak ve bu yapıyı bir plazmitin parçası olarak bir bakteri hücresine yerleştirmek.

49.) Keri Mullis, genomun bir DNA polyermaz ile tekrarlanan ısıtma ve soğutma döngüleri yoluyla bir genomun belirli bir bölümünün milyarlarca kopyasını yapmak için şu anda çok popüler bir metodolojinin ne olduğunu açıklamasıyla Nobel Ödülü kazandı. ilgilenilen bölge ve sadece birkaç ek reaktif. Bu amplifikasyon işlemine ne denir?

. Polimeraz zincir reaksiyonu (PCR).

50.) Glikozun yanması, mol başına 684 kcal açığa çıkarır. Glikozun sentezi, yanması uygun olduğu kadar enerjik olarak da elverişsizdir. Canlılar nasıl glikoz sentezini kendiliğinden bir reaksiyon haline getirebilir?

e. Olumsuz enerjileri, ATP'nin ADP ve Pi'ye dönüşümü gibi enerjik olarak uygun olan kimyasal reaksiyonlara bağlayarak.

51.) Tamamlayıcı DNA dizileri, öncelikle azotlu bazları arasında hidrojen oluşturma yeteneklerinden dolayı, birbirleri için doğal bir afiniteye sahiptir. Guaninler ve sitozinler arasında oluşan üç hidrojen bağı ve adeninler ile timinler arasında oluşan iki hidrojen bağına "baz çiftleri" denir. Bu hidrojen bağları, azotlu bir bazı DNA'daki deoksiriboz gibi bir şekere bağlayan kovalent bağlardan nasıl farklıdır?

NS. Kırılmak için fazla enerji almazlar çünkü gerçekte elektron paylaşımı gerçekleşmez.

52.) Glikoliz sırasında glikozdan ekstrakte edilen enerjinin çoğu başlangıçta sitrik asit döngüsünde NADH olarak toplanır. NADH'nin yüksek enerjili elektronları, mitokondri içinde bir proton gradyanı oluşturmak için kullanılır. Aşağıdaki enerjice zengin bileşiklerden hangisi, bu proton gradyanının doğrudan bir sonucu olarak sentezlenir?

53.) Prokaryotik organizma popülasyonları faaliyetlerini koordine ettiklerinde, bazı ökaryotik organizmaların karmaşıklığına rakip olmaya başlayan topluluklar oluşturabilirler. Bu tür bakteri popülasyonları, yakınlarda kaç bakteri olduğunu nasıl belirler?

54.) pH ve pOH birbiriyle ilişkilidir ve her ikisi de logaritmik ölçeklerdir. pOH'si 12 olan bir çözeltideki hidrojen iyonlarının konsantrasyonu ne olur?

55.) Glikolizin ilk adımında, altı karbonlu bir şeker olan glikoz, ATP ile etkileşime girer ve bunun sonucunda ADP ve ona bağlı bir fosfat grubu ile altı karbonlu bir şeker oluşur. Bu tepkimeyi katalize eden enzimin adı nedir?

56.) Dünyadaki tüm canlılar protein oluşturmak için aynı 20 amino asit setini kullanır. Bu 20 amino asit birbirinden nasıl farklıdır?

B. Her birinin kendi R grubu vardır.

57.) Karbon (6C), ikinci seviyesinin dört yörüngesinin her birinde sadece bir elektrona sahiptir. Aşağıda listelenen atomlardan hangisinin karbondan çok daha elektronegatif olmasını beklersiniz?

58.) Profazın sonuna yakın bir zamanda ayrılan nükleer zarların bileşenleri, yavru hücrelerin nükleer zarfını birleştirmek için yeniden kullanılır. Bu yeni nükleer zarlar mitozun hangi aşamasında oluşur?

59.) Dört tür biyopolimerin her birini yapmak için kullanılan farklı yapı taşları, her tür makromolekülün canlı hücrelerde farklı bir işleve sahip olmasına neden olur. Karbonhidratların, lipidlerin, proteinlerin ve nükleik asitlerin birincil rolleri nelerdir?

e. Sırasıyla enerji transferi, enerji depolama, kataliz ve bilgi depolama.

60.) Thomas Hunt Morgan tarafından gerçekleştirilen birçok meyve sineği genetiği deneyinden biri, homozigot beyaz gözlü ve sarı gövdeli bir sineğin (yw/yw) bu özellikler için heterozigot olan başka bir sinekle (yw/++) çiftleştirilmesini içeriyordu. Morgan, 487 neslin beyaz gözlü ve sarı gövdeli, 491'inin normal göz ve vücut rengine sahip, 10'unun beyaz gözlü ve normal vücut rengine sahip ve 12'sinin sarı gövdeli ve normal göz rengine sahip olduğunu buldu. y ve w genleri arasında kaç harita birimi vardır?

1.) Bir dizi çiftleşme deneyinde Thomas Hunt Morgan, meyve sineklerinde siyah vücut renginden ve zinober gözlerden sorumlu genlerin %9 sıklıkta yeniden birleştiğini buldu. Ayrıca zinober göz geninin körelmiş kanat geninden 9,5 harita birimi olduğunu da buldu. Siyah gövde rengi ve körelmiş kanatlar için genler hakkında ne sonuca varabilirsiniz?

B. %0,5 veya %18,5 sıklıkta yeniden birleşirler.

2.) Kuşlar cinsiyeti memelilerden farklı belirler - horozlar XX ve tavuklar XY'dir. Tavuk çiftçileri genellikle yeni doğan civcivlerin cinsiyetini tüylerinin renginden belirleyebilmeyi faydalı bulurlar. Bu, gümüş tüyler için X'e bağlı baskın alel (S) ve altın tüyler için çekinik alel (ler) kullanılarak nasıl yapılabilir?

C. Gümüş tavuklarla çiftleşen altın horozlar her zaman altın tavuklar ve gümüş horozlar üretecektir.

3.) DNA "de-oksi" nükleik asittir, çünkü ribozun 2' karbonundaki hidroksil grubu bir hidrojen atomu ile değiştirilir. Aşağıdaki karbonlardan hangisi aynı zamanda Sanger DNA dizileme yöntemi için kullanılan dide-oksi nükleotidlerinde "de-oksi"dir?

4.) İki gen, tek bir kromozom üzerinde ne kadar uzak olursa, mayoz bölünme sırasında aralarında sinaptonemal bir kompleks formuna sahip olmaları o kadar olasıdır. Ortaya çıkan rekombinasyon neden cinsel olarak üreyen organizmalara bir avantaj sağlıyor?

NS. Avantajlı genlerin dezavantajlı olanlarla ilişkisini kaybetmesine izin verir.

5.) Arthur Kornberg, canlı hücrelerde DNA'nın kopyalanmasından sorumlu olan enzimi E. coli'den ilk izole eden kişidir: DNA polimeraz. Aşağıdakilerden hangisi DNA zincirinin 5' ucunun doğru tanımıdır?

B. 5' hidroksil (-OH) grubu, bir fosfat grubundan başka bir şeye bağlı değildir.

6.) Arthur Kornberg deneyleri sırasında DNA polimerazların başka hangi şaşırtıcı özellik(ler)ini keşfetti?

e. 5' ila 3' yönünde nükleotidler eklerken, en azından kısa bir çift sarmallı DNA dizisiyle başlamalıdırlar.

7.) Nükleik asitler, kendi replikasyonlarını yönetme yetenekleri bakımından olağandışıdır. DNA'nın hangi özelliği/özellikleri onun bu olağandışı özelliğe sahip olmasına neden olur?

B. Bir dizide bulunan bilgi diğerindekiyle aynıdır.

8.) Tipik bir çift sarmallı DNA molekülündeki iki DNA zinciri hakkında aşağıdakilerden hangisi doğru bir ifadedir.

NS. İki iplik birbirine antiparalel olacaktır (bir ipliğin 5' ucu diğerinin 3' ucu ile eşleşecektir).

9.) 1978'de araştırmacılar, Vernon Ingram'ın, orak hücreli anemisi olan kişilerde bulunan -globin proteinindeki tek amino asit farkının, hastalığı olmayanlara göre o genin nükleotid dizisindeki tek bir farktan kaynaklandığı hipotezini doğruladı. Bir ikame olan spesifik mutasyon, aynı zamanda, bir kısıtlama enziminin, etkilenen bireylerde belirli bir DNA fragmanı oluşturmada başarısız olmasına neden oldu. Neydi o mutasyon?

C. Sağlıklı bireyin -globin geninde belirli bir konumda bir A'nın varlığına karşı aynı konumdaki hasta bireylerde bir T'nin varlığı.

10.) Her nükleotid, iki sabit kısımdan (bir fosfat grubu ve bir pentoz şeker) ve bir değişken azotlu bazdan oluşur. Aşağıdakilerden hangisi RNA ve DNA arasındaki farklardan biridir?

C. Bilgiyi ribozomlara iletmek için RNA, bilgiyi depolamak için DNA kullanılır.

11.) Bir organizmanın her bir hücresindeki DNA içeriğinin toplamı genellikle organizmanın "C-değeri" olarak adlandırılır. Genel bir kural olarak, C değerleri organizmanın karmaşıklığı ile ilişkilidir, ancak birlikte ele alındığında C değeri paradoksu olarak bilinen çarpıcı istisnalar vardır. Kurbağa genomunun insan genomundan yüzlerce kat daha büyük olduğu gözleminden çıkarılabilecek makul bir sonuç nedir?

B. Kurbağa genomunun çoğu "çöp" olmalıdır.

12.) Griffith, düz koloniler oluşturan Streptococcus pneumoniae'nin fareleri öldürebildiğini, ancak kaba kolonilerden gelen bakterilerin öldüremediğini buldu. Isı ile öldürülen düz bakteriler ve canlı kaba bakterilerin bir karışımı fareleri de öldürdü. Fareler öldükten sonra farelerde ne tür bakteri buldu?

13.) DNA moleküllerinde sadece dört farklı nükleotit olmasına rağmen, hücreler tarafından protein yapımında kullanılan 20 farklı amino asidin sırasını belirtmek için bulundukları özel sıra kullanılır. Dört farklı nükleotit içeren 64 olası üçlü kodon vardır. Altı farklı nükleotid olsaydı, kaç farklı olası üçlü kodon olurdu?

14.) Griffith'in çalışmasının bir sonucu olarak, Alfred Hershey ve Martha Chase 1952'de radyoaktif fosfor (32P) ve kükürt (35S) izotopları olan virüsleri radyoaktif olarak etiketlediler. saat, 32P ve 35S'yi nereden buldular?

. Sırasıyla hücrelerin içinde ve dışında.

15.) Alfred Hershey ve Martha Chase'in fosfor (32P) ve kükürtün (35S) radyoaktif izotopları ile radyoaktif olarak işaretlediği virüsler T2 bakteriyofajdı. T2 virüsleri, enfeksiyon döngüsünün ilk aşaması olarak konakçı hücrelerinin genomik DNA'sını yok eden T4 virüsleri gibi, bir elektron mikroskobu ile bakıldığında dış görünüşü gibi ayrıntılı, "ay-iner" bir görünüme sahiptir. Tüm virüslerin dış tabakası proteinlerden yapılmıştır. Aşağıdaki moleküllerden hangisi genetik bilgilerini depolamak için kullanılabilir?

16.) Meselson ve Stahl, iki farklı nitrojen izotopunu (15N ve 14N) kullanarak Watson ve Crick'in DNA replikasyonunun yarı-koruyucu bir süreçle gerçekleştiğine dair tahminini test eden bir deney tasarladılar. DNA replikasyonu gerçekten muhafazakar olsaydı, bir tur hücre bölünmesinden sonra ne bulurlardı?

NS. Bazı çift sarmallı DNA molekülleri sadece 15N içerirken diğerleri sadece 14N içerir.

17.) İnsan kromozomu 21'in (en küçüklerinden biri) haritalanması, 70.000'den fazla maya yapay kromozomu (YAC) klonunu taramak ve örtüşen bir dizi veren toplam 810 YAC'yi tanımlamak için kullanılan 198 dizi etiketli site (STS) gerektirdi. tüm kromozomu kapsayan klonlar. Bu tür haritalama için daha büyük maya yapay kromozomu (YAC) klonlarını kullanmak, plazmitler gibi bakteriyel vektörlerdeki daha küçük klonlardan neden daha uygundur?

NS. Bir kromozomun klonlanmış kısımları ne kadar büyük olursa, kromozomun fiziksel bir haritasını çıkarmak o kadar kolay olur.

18.) Genel bir kural olarak ökaryotlar, prokaryotlardan daha karmaşıktır. Prokaryotlar ve ökaryotlar arasındaki aşağıdaki farklılıklardan hangisi ökaryotik RNA polimerazlarının ve promotörlerinin prokaryotik karşılıklarından önemli ölçüde daha karmaşık olmasını gerektirir?

B. Ökaryotlar, gen ekspresyonunun dokuya özgü düzenlemesini başarmak zorundadır.

19.) Bir DNA zincirinin azotlu bazları 5' - TACGAA - 3' sırasına göre düzenlenmişse, tamamlayıcı zincirindeki nükleotidlerin sırası ne olur?

20.) İnsan DNA'sında dört nükleotid aşağıdaki yüzdelerde bulunur: A = %30,2 T = %30,2 G = %19,8 ve C = %19,8. Bu sayılar Chargaff kuralıyla nasıl tutarlı?

NS. DNA'daki A ve T'lerin molar oranı aynıdır.

Hücrelerde bulunan birçok RNA molekülü türünden hangisi, bir modifikasyonun varlığından dolayı ribozomlar tarafından özel olarak tanınır (bir “başlık”ın eklenmesi – olağandışı bir 5'-to-5' tri-fosfat bağlantısıyla tek bir guanin) 5' ucunda mı?

Prokaryotlardan farklı olarak ökaryotlar, genlerinin RNA transkriptlerini kapsamlı bir şekilde değiştirir. Bu işlem tamamlanmadan önce çağrılan proteinlere translasyon için hedeflenen ökaryotik RNA'lar nelerdir (yani, intronları henüz eklenmedi veya henüz poliadenile edilmedi).

hnRNA'lar (heterojen RNA'lar).

Hücreler yeni proteinleri çevirdikçe, uygun amino asitler, karakteristik bir haç biçiminde (yonca yaprağı) ikincil yapıya sahip bir RNA molekülü tarafından ribozomlara taşınır. Bu RNA molekülü ailesinin üyelerine ne denir?

Proteinler asla doğrudan DNA içinde depolanan bilgilerden yapılmaz. Bunun yerine bilgi, RNA polimeraz tarafından bir RNA ara ürününe kopyalanır. Bu RNA ara ürünlerinin adı nedir?

25.) Doktorların hastalarının tam genom diziliminden elde edilen bilgileri rutin olarak kullanmaları çok uzun sürmeyecektir. Bu bilgi, yasaklanmış ilaçların, mümkün olan en küçük doz ve yan etkilerle maksimum etkiyi sağlayacak şekilde belirli metabolizmaya göre ayarlanmasına izin vermelidir. Bu tür kişiselleştirilmiş tıbbın adı nedir?

26.) George Beadle ve Edward Tatum, genler ve enzimler arasındaki kesin ilişkiyi açıkladıkları için 1958'de Nobel ödülünü paylaştılar. Deney yaptıkları ekmek kalıbı genellikle şeker, tuz ve azot gibi sadece basit bileşikleri içeren bir ortamda iyi yetişirdi. Buldukları bazı oksotrofik mutantlar neden ortamlarında arginin gibi ek bileşikler gerektiriyordu?

e. Arginin sentezinde yer alan bir veya daha fazla gen mutasyona uğramıştı.

27.) Hem prokaryotlarda hem de ökaryotlarda tüm yeni proteinlere dahil edilen ilk amino asit metionindir. İki araştırmacı, prokaryotik ribozomların, translasyonu başlatmak için 5'-UAAGGAGG-3' (onların onuruna Shine-Delgarno dizisi olarak adlandırılmıştır) dizisini 5' bir başlangıç ​​kodonuna ihtiyaç duyduğunu buldu. Ribozomların bir mRNA salmasına ve büyüyen bir polipeptide amino asit eklemeyi bırakmasına neden olan nedir?

C. Ribozomlar, yüklü tRNA'ları olmayan bir kodonla karşılaştığında, mRNA'ları çevirmeyi durdururlar.

28.) Moleküler biyolojinin temel dogması nedir?

a. Bilgi DNA'dan RNA'ya ve proteine ​​geçer.

29.) 1960'larda, genetik kod, biri Nirenberg ve diğeri Ochoa tarafından yönetilen iki farklı araştırma grubu tarafından deşifre edildi. Ribozomların poli-urasil dizilerini (örneğin 5'-UUUUUUUUU-3') sadece amino asit fenilalanin içeren polipeptitlere çevirdiğini buldular. Bir fenilalanin tRNA'sının antikodonunun nükleotid dizisi nedir?

30.) François Jacob ve Jacques Monod tarafından gerçekleştirilen E. coli tarafından laktoz kullanımının genetik analizleri, bakteriyel gen düzenlemesi hakkında ilk önemli bilgileri sağladı ve "operon" kelimesinin türetilmesiyle sonuçlandı. Jacob ve Monod, laktoz metabolizması için gerekli olan genlerin çok yakın olduğunu ve E. coli'nin kromozomunda şu sırayla düzenlendiğini buldular: beta-galaktosidaz, laktoz permeaz ve transasetilaz. İlk çalışılan operonun bu genlerinin ortak noktası neydi?

31.) Kısa adı IPTG olan bir kimyasal, lak baskılayıcıya bağlanmak için laktoza yeterince benzer, ancak -galaktosidaz enzimi tarafından parçalanamaz. IPTG'nin varlığının lac operon'un ifadesi üzerinde ne etkisi olabilir?

B. Laktoz olmadığında bile lac operon yüksek seviyelerde ifade edilir.

32.) lacI geninin protein ürünü için bağlanma bölgesi normalde tüm E. coli genomunda yalnızca bir kez bulunur – lac operon operatörü. Moleküler biyologlar, bir E. coli genomunu, trp operonunun promotörünün aşağısındaki 50 nükleotitlik bağlanma bölgesinin nükleotid dizisini içerecek şekilde genetik olarak tasarlasaydı ne olurdu?

C. trp operonunun ifadesi, hücredeki laktoz seviyeleri ile de ilişkili olacaktır.

33.) Farklı Hfr suşları, bakteriyel kromozomlarının farklı kökenleri ve transfer yönleri sergiler. Beş farklı Hfr suşunun orijine (O) yakın genlerin transfer sırası aşağıda verilmiştir.

HFR Gerilme/genlerin ttransfer sırası

Aşağıdakilerden hangisi bir E. coli kromozomunun doğru eşlenik haritasının bir parçasıdır?

34.) Bir proteinin (siklik AMP reseptör proteini), beta-galaktosidaz geninin önündeki promotöre spesifik olarak bağlandığı, ancak yalnızca glikoz seviyeleri düşük olduğunda bulunduğu bulunmuştur. Sadece bu protein bağlandığında RNA polimeraz laktoz operonunun transkripsiyonuna başlayabilir. Bu protein ne tür gen ekspresyonunun düzenlenmesinde yer alır?

35.) Çoğu biyolojik yol, bir başlangıç ​​materyalinin bir son ürüne verimli bir şekilde dönüştürülmesi için hücrelerin iki veya daha fazla farklı enzime eşit miktarlarda sahip olmasını gerektirir. Prokaryotların hangi özelliği, bu tür yollarda genlerin koordineli ifadesini sağlamaya yardımcı olur?

B. İlgili işlevlere sahip genler genellikle tek bir operonda bulunur.

36.) Aşağıdakilerden hangisi E. coli'nin tek kromozomu ile insan hücrelerinin birçok kromozomu arasındaki önemli bir farktır?

a. E. coli'nin kromozomu dairesel, insan kromozomları ise doğrusaldır.

37.) Laktoz intoleransı olan insanlar artık lac operondaki beta galaktosidaza eşdeğer enzimi yapmazlar. Prokaryotik bir hücrenin lac operonundaki aşağıdaki mutasyonlardan hangisi onun beta galaktosidaz sentezlemesine engel olabilir?

Destekleyicinin silinmesi

38.) 70, sıraları sırasıyla “TTGACA” ve “TATAAT” olan Pribnow ve TATA kutularını içeren promotörleri en iyi tanıyan E. coli RNA polimerazının önemli bir bileşenidir. Promotör dizileri önemli ölçüde farklı olan genler, RNA polimerazları tarafından nasıl tanınabilir ve kopyalanabilir?

e. Farklı faktörleri olan RNA polimerazları tarafından kopyalanmaları gerekir.

39.) İnsan Genom Projesi, tüm genlerin insan kromozomları boyunca bulunduğu bir tür adres listesi derlemek için iddialı bir girişimdi. Bu "moleküler biyoloji ay çekiminde" yer alan DNA dizilemesinin tamamlanması, önceki genetik haritalama ve fiziksel haritalama aşamalarının bir sonucu olarak geldi. Bu çabanın dördüncü ve son aşaması neydi (ve hâlâ da öyle)?

e. Hangilerinin işlevsel olarak önemli olduğunu ve bu işlevin ne olabileceğini belirlemek için diğer organizmaların genomlarında bulunan homolog dizileri karşılaştırmak.

40.) Sir Alec Jefferies, ökaryotik mRNA'ların uzunluğunun aslında onları kodlayan genlerden çok daha kısa olduğunu, mRNA'ları genomik DNA'ya hibridize ettiğinde ve bir elektron mikroskobu ile ürünlere baktığında gerçekten gören ilk kişiydi. Ökaryotik genlerin birincil transkriptlerinden birleştirilen kodlamayan kısımlar nelerdir?

41.) Pek çok ökaryotik genom, kodlanmayan veya fazlalık DNA'nın geniş yollarını içerir. Bitkiler, evrimsel tarihleri ​​boyunca sık sık tüm genomlarının sayısız kopyasını biriktirmiş gibi görünüyor. Kopyası asıl amacına hizmet ettiği için işlevine artık ihtiyaç duyulmayan bir gene ne olur?

C. Bazıları, seçici bir avantaj sağlayan ve işlevsel kısıtlamaya giren yeni işlevler edinir.

42.) 1997'de Edinburgh, İskoçya'daki bilim adamları yetişkin bir Finn Dorset kuzusunu klonladılar. Bu çalışmayla ilgilenen araştırmacılar, klonlanacak kuzudan alınan nükleer DNA'nın kaynağı olarak meme hücrelerini kullanmaya özen gösterdiler çünkü bunların diğer memeli hücrelerinden daha az farklılaşmış oldukları biliniyor. Neden farklılaşmamış bir hücre hattından farklılaşmış bir hücre hattından bir çekirdek kullanmak gerekli olsun ki?

e. Hücreler farklılaştıkça kromatinlerinin bazı kısımlarını heterokromatine dönüştürürler ve bu durum sadık bir şekilde sonraki nesillere aktarılır.

43.) Edward Southern, kağıt benzeri zarlara bağlı DNA moleküllerinin, radyo-etiketli diğer serbest yüzen DNA molekülleri ile spesifik olarak hibritleşebileceğini gösteren ilk kişiydi. Southern'in tekniği DNA'nın aşağıdaki önemli özelliklerinden hangisine dayanmaktadır?

C. Tek sarmallı DNA'nın tamamlayıcı sarmalları birbirine afiniteye sahiptir.

44.) Kromozomlarımızın DNA'sında nükleotidlerin ortaya çıkma sırasını belirleme yeteneği, genetik kodumuzu doğrudan incelememize izin verdiği için, biyoloji çalışmasında açıkça büyük bir ilerlemeydi. Kullanılacak ilk DNA dizileme yöntemi, Maxam ve Gilbert'e Nobel Ödülü kazandırdı ve Sanger, kabaca on yıl sonra yeni bir yöntem geliştirene kadar yaygın olarak kullanıldı. Maxam ve Gilbert'in ve Sanger'ın yöntemleri nasıl farklıdır?

e. Birincisi, DNA'nın kimyasal bozulmasını içerirken, Sanger enzimatik bir işlemdir.

45.) Şeker hastaları genellikle hayatta kalmak için düzenli dozlarda insülin hormonuna ihtiyaç duyarlar. Aşağıdakilerden hangisi, bu tür tedaviler için insülin sağlayabilecek bir transgenik organizma yapmanın makul bir yolunu temsil eder?

e. İnsan insülin proteini için DNA dizisinin önüne bir bakteriyel promotör koymak ve bu yapıyı bir plazmitin parçası olarak bir bakteri hücresine yerleştirmek.

46.) Aşağıdakilerden hangisi nesneleri artan büyüklük sırasına göre sıralar?

e. Azotlu baz, nükleotid, gen, kromozom.

47.) HpaII kısıtlama enzimi, 5'-CCGG-3' nükleotid dizisiyle karşılaştığında DNA'da spesifik olarak çift sarmallı bir kırılma yapar. İnsan genomu kabaca 3.000.000.000 nükleotid uzunluğundaysa, HpaII kısıtlama alanlarının her birini kestiğinde kaç parçaya ayrılmasını beklersiniz?

Kabaca 11.700.000 (3.000.000.000.000/256).

48.) 35.000, insan genomundaki gen sayısı için iyi bir tahmindir. İnsan hücreleri, farklı dokularda farklı genleri ifade etmek için çok çeşitli mekanizmalar kullanır. Sonuç olarak, beyin ve karaciğer hücreleri arasında aşağıdakilerden hangisinin farklı olması muhtemeldir?

e. Kromozomlarının parçalarının paketlenmesi.

49.) Keri Mullis, genomun bir DNA polyermaz ile tekrarlanan ısıtma ve soğutma döngüleri yoluyla bir genomun belirli bir bölümünün milyarlarca kopyasını yapmak için şu anda çok popüler bir metodolojinin ne olduğunu açıklamasıyla Nobel Ödülü kazandı. ilgilenilen bölge ve sadece birkaç ek reaktif. Bu amplifikasyon işlemine ne denir?

. Polimeraz zincir reaksiyonu (PCR).

50.) Glikozun yanması, mol başına 684 kcal açığa çıkarır. Glikozun sentezi, yanması uygun olduğu kadar enerjik olarak da elverişsizdir. Canlılar nasıl glikoz sentezini kendiliğinden bir reaksiyon haline getirebilir?

e. Olumsuz enerjileri, ATP'nin ADP ve Pi'ye dönüşümü gibi enerjik olarak uygun olan kimyasal reaksiyonlara bağlayarak.

51.) Tamamlayıcı DNA dizileri, öncelikle azotlu bazları arasında hidrojen oluşturma yeteneklerinden dolayı, birbirleri için doğal bir afiniteye sahiptir. Guaninler ve sitozinler arasında oluşan üç hidrojen bağı ve adeninler ile timinler arasında oluşan iki hidrojen bağına "baz çiftleri" denir. Bu hidrojen bağları, azotlu bir bazı DNA'daki deoksiriboz gibi bir şekere bağlayan kovalent bağlardan nasıl farklıdır?

C. Kırılmak için fazla enerji almazlar çünkü gerçekte elektron paylaşımı gerçekleşmez.

52.) Glikoliz sırasında glikozdan ekstrakte edilen enerjinin çoğu başlangıçta sitrik asit döngüsünde NADH olarak toplanır. NADH'nin yüksek enerjili elektronları, mitokondri içinde bir proton gradyanı oluşturmak için kullanılır. Aşağıdaki enerjice zengin bileşiklerden hangisi, bu proton gradyanının doğrudan bir sonucu olarak sentezlenir?

53.) Prokaryotik organizma popülasyonları faaliyetlerini koordine ettiklerinde, bazı ökaryotik organizmaların karmaşıklığına rakip olmaya başlayan topluluklar oluşturabilirler. Bu tür bakteri popülasyonları, yakınlarda kaç bakteri olduğunu nasıl belirler?

54.) Zarlar genellikle hücreler tarafından, aksi takdirde uyumsuz reaksiyonların meydana gelebileceği çeşitli mikro-ortamlar yaratmak için kullanılır. Aşağıdaki hücre içi bölmelerden hangisi, bir zamanlar kendi başına özgür yaşayan bir organizma olduğu ve şimdi ökaryotik hücrelerde simbiyotik olarak yaşadığı gerçeğini yansıtabilecek bir çift zarla çevrilidir?

55.) Ökaryotlarda, glikoliz ve sitrik asit döngüsü süreçleri fiziksel olarak zar bölmeleriyle ayrılır. Sitrik asit döngüsü sırasında mitokondride üretilen NADH ve FADH molekülleri, glikozdan hasat edilebilir enerjinin büyük kısmını yanlarında taşır. Sitrik asit döngüsüne kendisiyle ilişkili bu kadar çok enerjiyle giren molekül nedir?

C. Koenzim A'ya (acetly-CoA) bağlı iki karbonlu bir molekül.

56.) Glikozun tam oksidasyonu, canlı hücrelerde büyük miktarda enerji açığa çıkarır: –686 kcal/mol net değişim. Hücreler, bu enerjinin mümkün olduğu kadar çoğunu, çok sayıda başka kimyasal reaksiyonu yürütmek için kullanılan enerji açısından zengin ATP moleküllerine dönüştürür. ATP'nin ADP'ye ve inorganik fosfata hidrolizi, –7.3 kcal/mol'lük bir serbest enerji değişimine sahiptir. Glikolizin sonunda glikozun piruvata dönüştürülmesi sırasında hücrelerin hasat ettiği net enerji miktarı nedir?

57.) Fotosentez, büyük aşamalara ayrılan oldukça organize bir süreçtir. Bir dizi reaksiyon ATP ve NADPH üretir ve ayrıca oksijen gazını (O2) serbest bırakır. Diğer grup, karbonhidratları sentezlemek için enerji açısından zengin ATP ve NADPH moleküllerini kullanır. Aşağıdaki tepkimelerden hangisi ışık yokluğunda gerçekleşmeye devam edebilir?

58.) Profazın sonuna yakın bir zamanda ayrılan nükleer zarların bileşenleri, yavru hücrelerin nükleer zarfını birleştirmek için yeniden kullanılır. Bu yeni nükleer zarlar mitozun hangi aşamasında oluşur?

59.) Dört tür biyopolimerin her birini yapmak için kullanılan farklı yapı taşları, her tür makromolekülün canlı hücrelerde farklı bir işleve sahip olmasına neden olur. Karbonhidratların, lipidlerin, proteinlerin ve nükleik asitlerin birincil rolleri nelerdir?

e. Sırasıyla enerji transferi, enerji depolama, kataliz ve bilgi depolama.

60.) Tohum renginin (G/g) ve tohum şeklinin (S/s) yeni izole edilmiş bir fasulye türünde iki farklı fakat bağlantılı gen tarafından kodlandığını varsayın. Gerçek üreyen yeşil (GG) pürüzsüz (SS) tohumlu bir bitki ile sarı (gg) buruşuk (ss) tohumlu bir bitki arasındaki çaprazlama, tüm bireylerin yeşil (Gg) pürüzsüz (Ss) tohumlu olduğu bir F1 nesli verir. Bir F2 neslinde 50 adet yeşil-pürüzsüz bitki, 30 adet sarı-kırışıklı bitki, 10 adet yeşil-kırışıklı bitki ve 10 adet sarı-pürüzsüz bitki gözlemlenmektedir. Bu fasulye türünde tohum rengi ve şekli için genleri ayıran kaç harita birimi var?


Proteinler fosfor içerir mi? Eğer bu doğruysa, o zaman alfred hershey ve martha Chase proteinlerin fosfor içermediği ifadesini nasıl kullanmıştır? - Biyoloji

Bu bölümün sonunda aşağıdakileri yapabileceksiniz:

  • DNA'nın dönüşümünü açıklayın
  • DNA'nın genetik materyal olduğunu belirlemeye yardımcı olan temel deneyleri tanımlayın
  • Chargaff kurallarını belirtin ve açıklayın

Mevcut DNA anlayışımız, nükleik asitlerin keşfi ve ardından çift sarmal modelinin geliştirilmesiyle başladı. 1860'larda, mesleği hekim olan Friedrich Miescher ((Şekil)), beyaz kan hücrelerinden (lökositler) fosfat açısından zengin kimyasalları izole etti. Bu kimyasalları isimlendirdi (sonunda DNA olarak bilinecekti) nüklein çünkü hücre çekirdeğinden izole edilmişlerdi.

Şekil 1. Friedrich Miescher (1844-1895) nükleik asitleri keşfetti.

Öğrenme Bağlantısı

Miescher'ın DNA'yı ve çekirdekteki ilişkili proteinleri keşfetmesine yol açan deneyini yürüttüğünü görmek için bu incelemeye tıklayın.

Yarım yüzyıl sonra, 1928'de İngiliz bakteriyolog Frederick Griffith, bakteriyel transformasyonun ilk gösterimini bildirdi - bir hücre tarafından dış DNA'nın alındığı ve böylece morfolojisini ve fizyolojisini değiştirdiği bir süreç. Griffith deneylerini streptokok pnömoni, pnömoniye neden olan bir bakteri. Griffith, bu bakterinin kaba (R) ve pürüzsüz (S) olarak adlandırılan iki suşu ile çalıştı. (İki hücre tipi, bir besleyici agar plakasında büyütülmüş kolonilerinin ortaya çıkmasından sonra "kaba" ve "pürüzsüz" olarak adlandırıldı.)

R suşu patojenik değildir (hastalığa neden olmaz). S suşu patojeniktir (hastalığa neden olur) ve hücre duvarının dışında bir kapsülü vardır. Kapsül, hücrenin konak farenin bağışıklık tepkilerinden kaçmasına izin verir.

Griffith, canlı S türünü farelere enjekte ettiğinde, zatürreden öldüler. Buna karşılık, Griffith canlı R suşunu farelere enjekte ettiğinde hayatta kaldılar. Başka bir deneyde, farelere ısıyla öldürülen S suşu enjekte ettiğinde, onlar da hayatta kaldı. Bu deney, kapsülün tek başına ölüm nedeni olmadığını gösterdi. Üçüncü bir deney setinde, farelere canlı R suşu ve ısıyla öldürülmüş S suşu karışımı enjekte edildi ve -şaşırmasına rağmen- fareler öldü. Canlı bakterilerin ölü fareden izole edilmesi üzerine, sadece bakteri S suşu geri kazanıldı. Bu izole edilmiş S suşu, taze farelere enjekte edildiğinde, fareler öldü. Griffith, ısıyla öldürülen S suşundan canlı R suşuna bir şeyin geçtiği ve onu patojenik S suşuna dönüştürdüğü sonucuna vardı. Bunu o çağırdı dönüştürme ilkesi ((Figür)). Bu deneyler artık Griffith'in dönüşüm deneyleri olarak biliniyor.

Şekil 2. Griffith'in transformasyon deneylerinde iki S. pneumoniae suşu kullanıldı. R suşu patojenik değildir, oysa S suşu patojeniktir ve ölüme neden olur. Griffith bir fareye ısıyla öldürülen S suşu ve canlı bir R suşu enjekte ettiğinde, fare öldü. S suşu ölü fareden kurtarıldı. Griffith, ısıyla öldürülen S suşundan R suşuna bir şeyin geçtiği ve bu süreçte R suşu S suşuna dönüştürdüğü sonucuna vardı. (kredi “canlı fare”: çalışmanın NIH tarafından değiştirilmesi kredi “ölü fare”: Sarah Marriage tarafından çalışmanın değiştirilmesi)

Bilim adamları Oswald Avery, Colin MacLeod ve Maclyn McCarty (1944), bu dönüştürücü ilkeyi daha fazla keşfetmekle ilgilendiler. S türünü ölü farelerden izole ettiler ve proteinleri ve nükleik asitleri (RNA ve DNA) kalıtım molekülü için olası adaylar olarak izole ettiler. Her bir bileşeni spesifik olarak bozunduran enzimler kullandılar ve daha sonra R suşunu dönüştürmek için her karışımı ayrı ayrı kullandılar. DNA bozulduğunda, ortaya çıkan karışımın artık bakterileri dönüştüremediğini, diğer tüm kombinasyonların ise bakterileri dönüştürebildiğini buldular. Bu onları DNA'nın dönüştürücü ilke olduğu sonucuna varmalarına yol açtı.

Kariyer Bağlantısı

Adli Bilimciler, bir göçmenlik davasını çözmek için ilk kez DNA analizi kanıtlarını kullandılar. Hikaye, Gana'dan Londra'ya dönen genç bir çocuğun annesiyle birlikte olmasıyla başladı. Havaalanındaki göçmenlik makamları, sahte bir pasaportla seyahat ettiğini düşünerek ondan şüphelendi. Çok ikna edildikten sonra annesiyle yaşamasına izin verildi, ancak göçmenlik makamları aleyhindeki davayı düşürmedi. Fotoğraflar da dahil olmak üzere her türlü delil yetkililere sunuldu, ancak buna rağmen sınır dışı işlemleri başlatıldı. Aynı zamanda, Birleşik Krallık'taki Leicester Üniversitesi'nden Dr. Alec Jeffreys, DNA parmak izi olarak bilinen bir teknik icat etmişti. Göçmenlik makamları yardım için Dr. Jeffreys'e başvurdu. Anne ve üç çocuğunun yanı sıra akraba olmayan bir anneden DNA örnekleri aldı ve örnekleri çocuğun DNA'sıyla karşılaştırdı. Biyolojik baba resimde olmadığı için, üç çocuğun DNA'sı, çocuğun DNA'sı ile karşılaştırıldı. Çocuğun DNA'sında hem anne hem de üç kardeşi için bir eşleşme buldu. Çocuğun gerçekten de annesinin oğlu olduğu sonucuna vardı.

Adli bilim adamları, belgeler, el yazısı, ateşli silahlar ve biyolojik örnekler dahil olmak üzere birçok öğeyi analiz eder. Saç, meni, tükürük ve kanın DNA içeriğini analiz ederler ve bunu bilinen suçluların DNA profillerinin bir veri tabanıyla karşılaştırırlar. Analiz, DNA izolasyonu, dizileme ve dizi analizini içerir. Adli bilim adamlarının bulgularını sunmak için mahkeme duruşmalarına çıkmaları bekleniyor. Genellikle şehir ve eyalet devlet kurumlarının suç laboratuvarlarında kullanılırlar. DNA teknikleriyle deneyler yapan genetikçiler aynı zamanda bilim ve araştırma kuruluşları, ilaç endüstrileri ve kolej ve üniversite laboratuvarlarında da çalışırlar. Adli bilim adamı olarak kariyer yapmak isteyen öğrenciler, kimya, biyoloji veya fizik alanında en az lisans derecesine ve tercihen bir laboratuvarda çalışma deneyimine sahip olmalıdır.

Avery, McCarty ve McLeod'un deneyleri, DNA'nın dönüşüm sırasında aktarılan bilgi bileşeni olduğunu gösterse de, DNA'nın hala biyolojik bilgiyi taşıyamayacak kadar basit bir molekül olduğu düşünülüyordu.Proteinler, 20 farklı amino asitleri ile daha olası adaylar olarak kabul edildi. 1952'de Martha Chase ve Alfred Hershey tarafından yürütülen belirleyici deney, DNA'nın gerçekten proteinler değil, genetik materyal olduğuna dair doğrulayıcı kanıtlar sağladı. Chase ve Hershey bir bakteriyofaj, yani bakterileri enfekte eden bir virüs üzerinde çalışıyorlardı. Virüsler tipik olarak basit bir yapıya sahiptir: kapsid adı verilen bir protein kaplaması ve genetik materyali (DNA veya RNA) içeren bir nükleik asit çekirdeği. Bakteriyofaj, yüzeyine yapışarak konak bakteri hücresini enfekte eder ve daha sonra nükleik asitlerini hücre içine enjekte eder. Faj DNA'sı, konak makineyi kullanarak kendisinin birden fazla kopyasını oluşturur ve sonunda konakçı hücre patlayarak çok sayıda bakteriyofaj serbest bırakır. Hershey ve Chase, enfekte hücrelerdeki proteini DNA'dan spesifik olarak ayırt edecek radyoaktif elementleri seçtiler. Protein kaplamasını etiketlemek için bir grup fajı radyoaktif kükürt, 35 S ile etiketlediler. Başka bir faj grubu, radyoaktif fosfor,32P ile etiketlendi. DNA'da fosfor bulunduğundan, protein bulunmadığından, protein değil DNA radyoaktif fosfor ile etiketlenecektir. Benzer şekilde, kükürt DNA'da bulunmaz, ancak metionin ve sistein gibi birkaç amino asitte bulunur.

Her faj partisinin hücreleri ayrı ayrı enfekte etmesine izin verildi. Enfeksiyondan sonra, faj bakteriyel süspansiyonu, faj kaplamasının konakçı hücreden ayrılmasına neden olan bir karıştırıcıya konuldu. Enfeksiyonun oluşması için yeterince uzun süre maruz kalan hücreler daha sonra iki radyoaktif molekülden hangisinin hücreye girdiğini görmek için incelendi. Faj ve bakteri süspansiyonu bir santrifüjde döndürüldü. Daha ağır bakteri hücreleri yerleşip bir pelet oluştururken, daha hafif faj parçacıkları süpernatanda kaldı. 35 S ile etiketlenmiş faj içeren tüpte, süpernatan radyoaktif olarak etiketlenmiş faj içerirken, pelette hiçbir radyoaktivite tespit edilmedi. 32P ile etiketlenmiş faj içeren tüpte, daha ağır bakteri hücrelerini içeren pelette radyoaktivite tespit edildi ve süpernatanda hiçbir radyoaktivite tespit edilmedi. Hershey ve Chase, enjekte edilenin faj DNA'sı olduğu sonucuna vardılar.
hücreye girer ve daha fazla faj parçacığı üretmek için bilgi taşır, böylece DNA'nın protein değil, genetik materyal olduğuna dair kanıt sağlar ((Şekil)).

Figür 3. Hershey ve Chase'in deneylerinde, bakteriler ya proteini etiketleyen 35S ya da DNA'yı etiketleyen 32P ile radyo-etiketlenmiş faj ile enfekte edildi. Bakteri hücrelerine sadece 32P girdi, bu da DNA'nın genetik materyal olduğunu gösteriyor.

Aynı sıralarda, Avusturyalı biyokimyacı Erwin Chargaff, farklı türlerdeki DNA içeriğini inceledi ve adenin, timin, guanin ve sitozin miktarlarının eşit miktarlarda bulunmadığını ve dört nükleotid bazının nispi konsantrasyonlarının türden türe farklılık gösterdiğini buldu. türlere değil, aynı bireyin dokuları içinde veya aynı türün bireyleri arasında değil. Ayrıca beklenmedik bir şey keşfetti: Adenin miktarının timin miktarına eşit olduğu ve sitozin miktarının guanin miktarına eşit olduğu (yani, A = T ve G = C). Farklı türlerin eşit miktarda pürinler (A+G) ve pirimidinler (T + C), ancak farklı A+T ila G+C oranları. Bu gözlemler Chargaff kuralları olarak bilinir hale geldi. Watson ve Crick, DNA çift sarmal modellerini önermeye hazırlanırken Chargaff'ın bulguları son derece yararlı oldu! Son birkaç sayfayı okuduktan sonra, bilimin, bazen yavaş ve zahmetli bir süreçte, önceki keşifler üzerine nasıl inşa edildiğini görebilirsiniz.

Bölüm Özeti

DNA ilk olarak, çekirdekten izole edildiği için ona nüklein adını veren Friedrich Miescher tarafından beyaz kan hücrelerinden izole edildi. Frederick Griffith'in suşlarla yaptığı deneyler streptokok pnömoni DNA'nın dönüştürücü ilke olabileceğine dair ilk ipucunu sağladı. Avery, MacLeod ve McCarty, bakterilerin transformasyonu için DNA'nın gerekli olduğunu gösterdi. Daha sonra Hershey ve Chase tarafından bakteriyofaj T2 kullanılarak yapılan deneyler, DNA'nın genetik materyal olduğunu kanıtladı. Chargaff, A = T ve C = G oranının ve A, T, G ve C'nin yüzde içeriğinin farklı türler için farklı olduğunu buldu.

Soruları İncele

Belirli bir türün DNA'sı analiz edilirse ve yüzde 27 A içerdiği bulunursa, C yüzdesi ne olur?


DNA Replikasyonunun Temelleri

Şekil 4. DNA replikasyonu için önerilen üç model. Gri, orijinal DNA ipliklerini gösterir ve mavi, yeni sentezlenmiş DNA'yı gösterir.

Çift sarmalın yapısının aydınlatılması, DNA'nın nasıl bölündüğü ve kendisini nasıl kopyaladığı konusunda bir ipucu verdi. Bu model, çift sarmalın iki ipliğinin replikasyon sırasında ayrıldığını ve her bir ipliğin, yeni tamamlayıcı ipliğin kopyalandığı bir şablon görevi gördüğünü ileri sürer. Açık olmayan şey, çoğaltmanın nasıl gerçekleştiğiydi. Önerilen üç model vardı: muhafazakar, yarı muhafazakar ve dağınık (bkz. Şekil 4).

Konservatif replikasyonda ebeveyn DNA'sı bir arada kalır ve yeni oluşan yavru iplikler bir aradadır. Yarı muhafazakar yöntem, iki ebeveyn DNA zincirinin her birinin, replikasyondan sonra sentezlenecek yeni DNA için bir şablon görevi gördüğünü, her çift sarmallı DNA'nın bir ebeveyn veya "eski" iplik ve bir "yeni" iplik içerdiğini ileri sürer. Dağıtıcı modelde, DNA'nın her iki kopyası da çift sarmallı ana DNA parçalarına ve serpiştirilmiş yeni sentezlenmiş DNA'ya sahiptir.

Meselson ve Stahl, DNA'nın nasıl eşlendiğini anlamakla ilgilendiler. Büyüdüler E. koli nitrojenli bazlara ve sonunda DNA'ya katılan “ağır” bir nitrojen izotopu (15 N) içeren bir ortamda birkaç nesil boyunca.

Şekil 5. Meselson ve Stahl, önce ağır nitrojende (15 N), ardından 14 N'de yetiştirilen E. coli ile deney yaptılar. 15 N'de (kırmızı bant) büyütülen DNA, 14 N'de (turuncu bant) büyütülen DNA'dan daha ağırdır ve çökeltiler bir ultrasantrifüjde sezyum klorür çözeltisinde daha düşük bir seviye. 15 N'de büyütülen DNA, 14 N içeren ortama geçirildiğinde, bir tur hücre bölünmesinden sonra DNA, 15 N ve 14 N seviyelerinin ortasında çöker, bu da şimdi yüzde elli 14 N içerdiğini gösterir. DNA miktarı sadece 14 N içerir. Bu veriler, yarı muhafazakar çoğaltma modelini destekler. (kredi: Mariana Ruiz Villareal tarafından yapılan çalışmanın modifikasyonu)

NS E. koli kültür daha sonra 14 N içeren ortama aktarıldı ve bir nesil boyunca büyümesine izin verildi. Hücreler toplandı ve DNA izole edildi. DNA, bir ultrasantrifüjde yüksek hızlarda santrifüjlendi. Bazı hücrelerin 14 N'de bir yaşam döngüsü daha büyümesine izin verildi ve tekrar döndürüldü. Yoğunluk gradyanlı santrifüjleme sırasında, DNA bir gradyana (tipik olarak sezyum klorür veya sakaroz gibi bir tuz) yüklenir ve 50.000 ila 60.000 rpm'lik yüksek hızlarda döndürülür. Bu şartlar altında DNA, gradyandaki yoğunluğuna göre bir bant oluşturacaktır. 15 N'de büyütülen DNA, 14 N'de yetiştirilenden daha yüksek bir yoğunluk pozisyonunda bant oluşturacaktır. Meselson ve Stahl, 15 N'den kaydırıldıktan sonra 14 N'de bir nesil büyümeden sonra, gözlemlenen tek bandın pozisyonunda orta seviyede olduğunu kaydetti. sadece 15 N ve 14 N'de büyütülen hücrelerin DNA'sı arasında. Bu, ya yarı-koruyucu ya da dağıtıcı bir replikasyon modu önerdi. İki nesil boyunca 14 N'de büyütülen hücrelerden toplanan DNA iki bant oluşturdu: bir DNA bandı 15 N ile 14 N arasında ara pozisyondaydı ve diğeri 14 N DNA bandına karşılık geldi. Bu sonuçlar ancak DNA'nın yarı muhafazakar bir şekilde replike olması durumunda açıklanabilir. Bu nedenle, diğer iki mod ekarte edildi.

DNA replikasyonu sırasında, çift sarmalı oluşturan iki zincirin her biri, yeni zincirlerin kopyalandığı bir şablon görevi görür. Yeni dizi, ebeveyn ya da "eski" diziyi tamamlayıcı olacaktır. İki yavru DNA kopyası oluşturulduğunda, aynı diziye sahiptirler ve iki yavru hücreye eşit olarak bölünürler.


Keşfetmekten Anlamaya

Oswald Avery (1877–1955) ve meslektaşlarının DNA'nın bakterileri dönüştürebileceğini gösterdikleri 1940'ların ortalarına kadar DNA'nın genetik bilginin taşıyıcısı olarak rolü anlaşılmamış gibi görünebilir ( Avery ve diğerleri, 1944 ). Bu deneyler DNA'nın işlevi için doğrudan kanıt sağlasa da, hücre çoğalması, döllenmesi ve kalıtsal özelliklerin aktarılması gibi süreçlerde önemli bir rolü olabileceğine dair ilk fikirler, yarım yüzyılı aşkın bir süre önce ortaya atılmıştı. 1869'da (Miescher, 1869a) DNA'yı keşfeden İsviçreli bilim adamı Friedrich Miescher (1844–1895 Şekil 1), DNA'nın işlevini ve biyolojik moleküllerin bilgiyi nasıl kodlayabildiğini açıklamak için şaşırtıcı derecede anlayışlı teoriler geliştirdi. Fikirleri bugünün bakış açısından yanlış olsa da, çalışmaları mevcut anlayışımıza umut verici bir şekilde yaklaşan kavramlar içeriyor. Ancak Miescher'in kariyeri, bilimsel kavrayışlarının ötesinde dersler de içeriyor. Bu, bilim tarihinin en temel keşiflerinden birini yapma yolunda ilerleyen, sonunda yerleşik teorilere bağlı kaldığı ve bulgularının yorumunu takip edemediği için potansiyelinin gerisinde kalan parlak bir bilim adamının hikayesidir. yeni bir ışıkta.

…bilim tarihindeki en temel keşiflerden birini yapma yolunda ilerleyen parlak bir bilim insanı […] kurulu teorilere bağlı kaldığı için potansiyelinin gerisinde kaldı…

Bu alandaki en belirleyici keşiflerden üçünün on yıl içinde meydana gelmesi, genetik tarihinde ilginç bir tesadüftür: 1859'da Charles Darwin (1809-1882) Doğal Seleksiyon Yoluyla Türlerin Kökeni ÜzerineYedi yıl sonra türlerin evrimini yönlendiren mekanizmayı açıkladığı Gregor Mendel'in (1822-1884) kalıtımın temel yasalarını açıklayan makalesi çıktı ve 1869'un başlarında Miescher DNA'yı keşfetti. Yine de, Darwin'in teorisinin büyüklüğü hemen hemen fark edilmiş olmasına ve en azından Mendel'in kendisinin çalışmasının önemini kavramış gibi görünmesine rağmen, Miescher genellikle keşfinin öneminden habersiz olarak görülüyor. Oswald Avery, Colin MacLeod (1909–1972) ve Maclyn McCarthy'nin (1911–2005) DNA'nın genetik bilginin taşıyıcısı olduğunu ikna edici bir şekilde gösterebilmeleri için bir 75 yıl daha ve James Watson ve Francis Crick'ten (1916–2004) önce bir on yıl daha geçecekti. ) yapısını çözerek (Watson & Crick, 1953), DNA'nın bilgiyi nasıl kodladığını ve bunun proteinlere nasıl çevrildiğini anlamamızın yolunu açtı. Ancak Miescher, DNA'nın işlevine ilişkin şaşırtıcı kavrayışlara zaten sahipti.

1868 ve 1869 yılları arasında Miescher, yaşamın kimyasal temelini anlamaya çalıştığı Almanya'daki Tübingen Üniversitesi'nde çalıştı (Şekil 2,3). Yaklaşımındaki daha önceki girişimlere kıyasla çok önemli bir fark, tüm organlar veya dokular yerine izole hücrelerle (irinden elde ettiği lökositler) ve daha sonra saflaştırılmış çekirdeklerle çalışmasıydı. Geliştirdiği yenilikçi protokoller, izole edilmiş bir organelin kimyasal bileşimini araştırmasına izin verdi (Dahm, 2005), bu da başlangıç ​​materyalinin karmaşıklığını önemli ölçüde azalttı ve bileşenlerini analiz etmesini sağladı.

Miescher, dikkatle tasarlanmış deneylerde DNA'yı -ya da kendi deyimiyle "Nüklein"i keşfetti ve onun o dönemde bilinen diğer biyolojik molekül sınıflarından farklı olduğunu gösterdi (Miescher, 1871a). En önemlisi, nükleinin yüksek fosfor içeriğine sahip temel bileşimi, onu bir madde keşfettiği konusunda ikna etti. kendine özgüyani, Miescher'in Tübingen'deki akıl hocası, ünlü biyokimyacı Felix Hoppe-Seyler (1825–1895 Hoppe-Seyler, 1871 Miescher, 1871a) tarafından sonradan onaylanan kendi türünde bir sonuç. İlk analizlerinden sonra Miescher, nükleinin önemli bir molekül olduğuna ikna oldu ve ilk yayınında “proteinlere eşit sayılmayı hak edeceğini” önerdi (Miescher, 1871a).

Ayrıca Miescher, nükleinin çekirdeği tanımlamak için kullanılabileceğini hemen fark etti (Miescher, 1870). Bu önemli bir farkındalıktı, çünkü o zamanlar çekirdeklerin kesin olarak tanımlanması ve dolayısıyla bunların incelenmesi, morfolojileri, hücre altı lokalizasyonları ve boyama özellikleri dokular, hücre tipleri ve hücrelerin durumları arasında farklılık gösterdiğinden, elde edilmesi genellikle zor hatta imkansızdı. Bunun yerine, Miescher, çekirdeklerin karakterizasyonunu bu molekülün varlığına dayandırmayı önerdi (Miescher, 1870, 1874). Ayrıca, çekirdeğin, nüklein ile yakından bağlantılı olduğuna inandığı fizyolojik aktivitesi ile ilgili özelliklerle tanımlanması gerektiğini savundu. Böylece Miescher, bir organeli görünüşünden çok işlevine göre tanımlamaya yönelik önemli bir ilk adımı atmış oldu.

Daha da önemlisi, bulguları, birçok bilim adamının bu organel hakkında benzersiz hiçbir şey olmadığını varsaydığı bir zamanda, çekirdeğin sitoplazmadan kimyasal olarak farklı olduğunu da gösterdi. Böylece Miescher, hücrelerin farklı moleküler bileşim ve işlevlere sahip bölmelere bölündüğünün daha sonraki farkına varmanın yolunu açtı. Miescher, nükleinin kendisini "protoplazmadan" (sitoplazmadan) ayırabildiğine dair gözlemlerine dayanarak, "nükleinin protoplazmada dağılmış olma (çekirdeğin) olasılığını öne sürecek kadar ileri gitti. Bazıları yeni çekirdek oluşumları” (Miescher, 1874). Hücre bölünmesinden sonra çekirdeğin kromozomlar etrafında yeniden şekillendiğini tahmin ediyor gibiydi, ancak ne yazık ki bunun hangi koşullarda gerçekleşebileceği konusunda ayrıntılı bilgi vermedi. Bu nedenle, hangi koşullara atıfta bulunduğunu kesin olarak bilmek imkansızdır.

Böylece Miescher, hücrelerin farklı moleküler bileşim ve işlevlere sahip bölmelere bölündüğünün daha sonra farkına varılmasının yolunu açtı.

Bu bağlamda, 1872'de Edmund Russow'un (1841-1897) kromozomların bazik çözeltilerde çözülür gibi göründüğünü gözlemlediğini belirtmek ilginçtir. Şaşırtıcı bir şekilde, Miescher ayrıca asitleri kullanarak nükleini çökeltebileceğini ve daha sonra pH'ı artırarak onu çözeltiye geri döndürebileceğini bulmuştu (Miescher, 1871a). Ancak o sırada, nüklein ve kromatin arasındaki bağlantıyı kurmadı. Bu, yaklaşık on yıl sonra, 1881'de, Eduard Zacharias (1852-1911), Miescher'in nükleini karakterize ederken kullandığı bazı yöntemleri kullanarak kromozomların doğasını incelediğinde oldu. Zacharias, nüklein gibi kromozomların pepsin solüsyonları tarafından sindirilmeye dirençli olduğunu ve pepsin ile muamele edilmiş hücreleri seyreltik alkali solüsyonlarla ekstrakte ettiğinde kromatinin kaybolduğunu buldu. Bu, Walther Flemming'in (1843–1905) 1882'de nüklein ve kromatinin özdeş olduğu konusunda spekülasyon yapmasına yol açtı (Mayr, 1982).

Ne yazık ki, Miescher ikna olmamıştı. Bu gelişmeleri kabul etme konusundaki isteksizliği, en azından kısmen, Miescher'e göre, kimyasal yaklaşımların kesinliğinden yoksun olan sitologların ve histologların yöntemlerine ve dolayısıyla sonuçlarına yönelik derin bir şüpheciliğe dayanıyordu. Bununla birlikte, DNA'nın çekirdeğin işleviyle hayati bir şekilde bağlantılı olduğu gerçeği, Miescher'in zihnine sağlam bir şekilde yerleşmişti ve sonraki yıllarda ek kanıtlar elde etmeye çalıştı. Daha sonra şunları yazdı: "Her şeyden önce, bir dizi uygun bitki ve hayvan örneğini kullanarak, Nuclein'in gerçekten özel olarak çekirdeğin yaşamına ait olduğunu kanıtlamak istiyorum" (Miescher, 1876).

DNA'nın asidik doğası, büyük moleküler ağırlığı, temel bileşimi ve çekirdekteki varlığı -hepsi önce Miescher tarafından belirlenen- merkezi özelliklerinden bazıları olsa da, işlevi hakkında hiçbir şey açıklamazlar. Miescher, yeni bir molekül türü keşfettiğine kendini inandırarak, hızla farklı biyolojik bağlamlardaki rolünü anlamaya başladı. İlk adım olarak, nükleinin çeşitli hücre tiplerinde meydana geldiğini belirledi. Ne yazık ki, numunelerinin türetildiği doku türleri veya türler hakkında ayrıntılı bilgi vermedi. Üzerinde çalıştığı örneklerle ilgili tek ipucu, amcası İsviçreli anatomist Wilhelm His'e (1831-1904) ve ebeveynleri babası Friedrich Miescher-His'e (1811-1887) yazdığı mektuplardan geliyor. anatomi profesörüydü. Miescher'in yerli Basel'inde. Miescher yazışmalarında karaciğer, böbrek, maya hücreleri, eritrositler ve tavuk yumurtaları gibi nükleinin varlığı için araştırdığı diğer hücre tiplerinden bahsetmiş ve bunlarda da nüklein bulduğunu ima etmiştir (Miescher, 1869b His, 1897). . Ayrıca, Miescher ayrıca bitkilerde, özellikle sporlarında nüklein aramayı planlamıştı (Miescher, 1869c). Bu, onun daha sonraki omurgalı germ hücrelerine olan hayranlığı ve döllenme ve kalıtım süreçleri üzerine spekülasyonları göz önüne alındığında ilgi çekici bir seçimdir (Miescher, 1871b, 1874).

Miescher'in incelemiş olabileceği doku ve hücre tiplerine ilişkin bir başka ipucu da, Hoppe-Seyler tarafından yayınlanan ve öğrencisinin başlangıçta şüpheyle baktığı sonuçları yayınlanmadan önce doğrulamak isteyen iki makaleden geliyor. İlkinde, Hoppe-Seyler'in bir başka öğrencisi olan Pal Plósz, nükleinin yılanların ve kuşların çekirdekli eritrositlerinde bulunduğunu, ancak ineklerin çekirdeksiz eritrositlerinde bulunmadığını bildirdi (Plósz, 1871). İkinci makalede, Hoppe-Seyler, Miescher'in bulgularını doğruladı ve maya hücrelerinde nüklein tespit ettiğini bildirdi (Hoppe-Seyler, 1871).

Miescher, ölümünden sonra yayınlanan 1871 tarihli makalesine bir ekte, nükleinin görünüşte her yerde bulunmasının, "en gelişmiş organizmalar için olduğu kadar en temel canlıların yaşamı için de yeni bir faktörün bulunduğu" anlamına geldiğini belirtti. genel olarak fizyoloji için çok çeşitli sorular (Miescher, 1870). Miescher'in DNA'nın tüm yaşam biçimlerinin temel bir bileşeni olduğunu anladığını iddia etmek, muhtemelen onun sözlerinin aşırı yorumlanmasıdır. Bununla birlikte, ifadesi, DNA'nın çok çeşitli türlerin yaşamında önemli bir faktör olduğuna inandığını açıkça göstermektedir.

Ek olarak, Miescher dokuları farklı fizyolojik koşullar altında inceledi. Örneğin, çoğalan dokularda hem nüklein hem de çekirdeklerin önemli ölçüde daha fazla olduğunu hemen fark etti, bitkilerde büyük miktarlarda fosforun ağırlıklı olarak büyüme bölgelerinde bulunduğunu ve bu kısımların en yüksek çekirdek yoğunluklarını ve aktif olarak çoğalan hücreleri gösterdiğini kaydetti. Miescher, 1871a). Böylece Miescher, fosforun -yani bu bağlamda DNA'nın- varlığını hücre çoğalmasıyla ilişkilendirmeye yönelik ilk adımı atmış oldu. Birkaç yıl sonra, yumurtlama alanlarına doğru yukarı doğru göç eden somon balıklarının vücutlarındaki değişiklikleri incelerken, çok az bir çabayla, hücre proliferasyonunun zirvesinde oldukları için testislerden büyük miktarlarda saf nükleini saflaştırabildiğini fark etti. çiftleşmeye hazırlanırken (Miescher, 1874).Bu, proliferasyon ile yüksek konsantrasyonda nüklein varlığı arasındaki bağlantı için ek kanıt sağladı.

Bununla birlikte, Miescher'in bu konudaki en anlayışlı yorumları, Hoppe-Seyler'in Tübingen'deki laboratuvarındaki zamanından kalmadır. Histokimyasal analizlerin belirli patolojik durumların mikroskobik çalışmalardan çok daha iyi anlaşılmasına yol açacağına inanıyordu. Ayrıca, kimya daha iyi anlaşılırsa, o zamanlar benzer görülen fizyolojik süreçlerin çok farklı olabileceğine inanıyordu. Daha nükleini keşfettiği yıl olan 1869'da His'e yazdığı bir mektupta şunları yazmıştı: “Nükleer maddelerin [DNA], proteinlerin ve ikincil bozunma ürünlerinin nispi miktarlarına dayanarak, nükleinlerin fizyolojik önemini değerlendirmek mümkün olacaktır. şimdi mümkün olandan daha fazla doğrulukla değişir” (Miescher, 1869c).

Önemli olarak, Miescher bu tür analizlerden faydalanabilecek üç örnek süreç önerdi: sitoplazmik proteinlerde bir artış ve hücrenin genişlemesi ile karakterize edilen “besleyici ilerleme”, “nükleer maddelerde” (nüklein) bir artış olarak tanımlanan “üretici ilerleme”. ve çoğalan hücrelerde ve muhtemelen tümörlerde ve "gerilemede" hücre bölünmesinin bir ön aşaması olarak, lipidlerin ve dejeneratif ürünlerin bir birikimi olarak (Miescher, 1869c).

İlk iki kategoriyi ele aldığımızda, Miescher, DNA'daki bir artışın sadece hücre proliferasyonu ile ilişkili olmadığını, aynı zamanda bir ön koşul olduğunu anlamış görünüyor. Daha sonra, artık çoğalmayan hücreler, proteinlerin sentezi ve dolayısıyla sitoplazma yoluyla boyut olarak artacaktır. En önemlisi, bu tür farklı durumların kimyasal analizlerinin, bu süreçlerin altında yatan nedenlere dair daha temel bir kavrayış elde etmesini sağlayacağına inanıyordu. Bunlar şaşırtıcı derecede ileri görüşlü kavrayışlardır. Ne yazık ki, Miescher bu fikirleri hiçbir zaman takip etmedi ve mektubunda ifade edilen düşüncelerin dışında bu konuda hiçbir zaman yayınlanmadı.

… Miescher, DNA'daki bir artışın yalnızca hücre çoğalmasıyla ilişkili olmadığını, aynı zamanda hücre çoğalması için bir ön koşul olduğunu anlamış görünüyor.

Bununla birlikte, bu görüşleri destekleyen ön verilere sahip olması muhtemeldir. Miescher genellikle ifadeleri spekülasyondan ziyade gerçeklere dayandırmaya özen gösterirdi. Ancak, ancak sonuçlarını kapsamlı bir şekilde doğruladıktan sonra yayınlayan bir mükemmeliyetçi olarak, muhtemelen bu çalışmaları hiçbir zaman bu kadar tatmin edici bir noktaya getirmedi. Planlarının, Leipzig'deki Carl Ludwig (1816-1895) gözetiminde ek eğitim almak üzere Hoppe-Seyler'in laboratuvarından ayrılarak yarıda kesilmesi olasıdır. Oradayken, Miescher dikkatini DNA ile tamamen ilgisi olmayan konulara çevirdi ve ancak 1871'de memleketi Basel'e döndükten sonra nüklein üzerindeki çalışmalarına devam etti.

Bu müteakip nüklein çalışmaları için çok önemli olan Miescher önemli bir seçim yaptı: ana DNA kaynağı olarak sperme döndü. Farklı türlerden gelen spermleri analiz ederken, özellikle somondan elde edilen spermlerin nispeten küçük kuyruklara sahip olduğunu ve bu nedenle esas olarak bir çekirdekten oluştuğunu kaydetti (Miescher, 1874). Bunun DNA'yı çok daha yüksek saflıkta izole etme çabalarını büyük ölçüde kolaylaştıracağını hemen anladı (Şekil 4). Yine de Miescher, somon sperminden saf nüklein elde etme olasılığının ötesini de gördü. Ayrıca, çekirdeğin ve içindeki çekirdeklerin, döllenmede ve kalıtsal özelliklerin iletilmesinde çok önemli bir rol oynayabileceğini gösterdiğini fark etti. Würzburg'da meslektaşı Rudolf Boehm'e (1844–1926) yazdığı bir mektupta Miescher şunları yazdı: “Sonuçta, sadece sperm fizyolojisi için değil, daha temel öneme sahip kavrayışlar bekliyorum” ( Miescher, 1871c ). Bu, Miescher'i ömrünün sonuna kadar meşgul edecek olan döllenme ve kalıtım fenomenine duyduğu hayranlığın başlangıcıydı.

Miescher bu alana kritik bir zamanda girmişti. On dokuzuncu yüzyılın ortalarına gelindiğinde, hücrelerin spontane oluşum yoluyla ortaya çıktığına dair eski görüşe meydan okunmuştu. Bunun yerine, hücrelerin her zaman diğer hücrelerden kaynaklandığı yaygın olarak kabul edildi (Mayr, 1982). Özellikle 1800'lerin ortalarında hücre olduğu gösterilen spermatozoa ve oositlerin gelişimi ve işlevi yeni bir ışık altında görüldü. Ayrıca, 1866'da, Miescher'in DNA'yı keşfetmesinden üç yıl önce, Ernst Haeckel (1834–1919), çekirdeğin kalıtsal özellikleri ileten faktörleri içerdiğini varsaymıştı. Zamanın en etkili bilim adamlarından birinin bu önerisi, çekirdeği birçok biyolog için ilgi odağı haline getirdi. Nükleini yalnızca bu organelde bulunan ayırt edici bir molekül olarak keşfeden Miescher, bu alana katkıda bulunmak için mükemmel bir konumda olduğunu fark etti. Böylece, kimyasal özelliklerini hücrelerin, özellikle de sperm hücrelerinin morfolojisi ve işlevi ile ilişkilendirmek amacıyla nükleini daha iyi karakterize etmeye çalışmaya başladı.

Somon spermatozoa kafalarının kimyasal bileşimine ilişkin analizleri, Miescher'in iki temel bileşeni tanımlamasına yol açtı: asidik nükleinlere ek olarak, kendisi için 'protamin' terimini türettiği bir alkalin protein buldu, adı bugün hala kullanılmaktadır. spermatogenez sırasında histonların yerini alan küçük proteinler. Ayrıca bu iki molekülün “eter benzeri [yani kovalent] bir birliktelik değil, tuz benzeri bir birliktelik” içinde oluştuğunu belirledi (Miescher, 1874). Spermin kimyasal bileşimine ilişkin titiz analizlerinin ardından, “belirtilen maddeler [protamin ve nüklein] dışında önemli miktarda hiçbir şey bulunmadığı sonucuna varmıştır. Bu, döllenme teorisi için çok önemli olduğu için, bu işi en başından itibaren mümkün olduğu kadar niceliksel olarak yürütüyorum” (Miescher, 1872a). Analizleri ona, spermdeki DNA ve protaminlerin sabit oranlarda oluştuğunu, Miescher'in "kesinlikle özel bir öneme sahip" olduğunu düşündüğü bir gerçeği gösterdi, ancak bu önemli olabilir. Bugün, elbette, histonlar ve protaminler gibi proteinlerin DNA'ya tanımlanmış stokiyometrik oranlarda bağlandığını biliyoruz.

Miescher, sazan ve kurbağaların spermlerini analiz etmeye devam etti (Rana esculenta) ve büyük miktarlarda nükleinin varlığını doğruladığı boğalar (Miescher, 1874). Daha da önemlisi, nükleinin yalnızca spermin başlarında bulunduğunu (kuyrukların büyük ölçüde lipitlerden ve proteinlerden oluştuğunu) ve kafanın içinde nükleinin çekirdekte bulunduğunu gösterebildi (Miescher, 1874 Schmiedeberg & Miescher, 1896). Bu keşifle Miescher, DNA'nın spermatozoanın değişmez bir bileşeni olduğunu göstermekle kalmadı, aynı zamanda dikkatini sperm başlarına da yöneltti. Albert von Kölliker'in (1817-1905) bazı çokayaklılar ve araknidlerdeki spermlerin morfolojisine ilişkin gözlemlerine dayanarak, Miescher bazı türlerin spermlerinin aflagellat olduğunu, yani bir kuyruğu olmadığını biliyordu. . Bu, sperm başının ve dolayısıyla çekirdeğin çok önemli bir bileşen olduğunu doğruladı. Ancak soru şuydu: Sperm hücrelerinde döllenmeye ve kalıtsal özelliklerin bir nesilden diğerine aktarılmasına aracılık eden nedir?

Miescher, sperm üzerinde yaptığı kimyasal analizlere dayanarak, bu süreçlerde çok önemli bir yere sahip olan moleküllerin varlığına dair spekülasyonlar yaptı. Miescher, Boehm'e yazdığı bir mektupta şunları yazmıştı: "Kimyasallar üremede bir rol oynuyorsa, o zaman belirleyici faktör artık bilinen bir maddedir" (Miescher, 1872b). Ancak Miescher bu maddenin ne olabileceğinden emin değildi. Bununla birlikte, nüklein ve protamin kombinasyonunun anahtar olduğundan ve oositin gelişebilmek için çok önemli bir bileşenden yoksun olabileceğinden kuvvetle şüpheleniyordu: aktif bir düzenlemeyi oluşturan faktörlerin bir unsuru kaldırıldı mı? Aksi takdirde, yumurtada tüm uygun hücresel maddeler bulunur” diye yazdı (Miescher, 1872b).

Oositte protamini tespit edememesi nedeniyle, Miescher başlangıçta bu molekülü döllenmeden sorumlu olarak tercih etti. Ancak daha sonra, boğalar gibi diğer türlerin spermlerinde protamini tespit edemediğinde fikrini değiştirdi: “Bunun aksine, Nüklein'in sabit olduğu [yani, Miescher'in analiz ettiği tüm türlerin sperm hücrelerinde mevcut olduğu] kanıtlandı. ] şimdiye kadar ona ve onun çağrışımlarına bundan sonra ilgimi çekeceğim” (Miescher, 1872b). Ancak ne yazık ki, cesaret verici bir şekilde yakınlaşmasına rağmen, nüklein ve kalıtım arasında hiçbir zaman net bir bağlantı kuramadı.

Farklı omurgalı türlerinin spermatozoalarında nükleinin oluşumu ve özellikleri üzerine 1874 tarihli makalesinin son bölümü özellikle ilgi çekicidir çünkü Miescher nüklein hakkındaki kimyasal bulgularını spermatozoanın fizyolojik rolü ile ilişkilendirmeye çalışmıştır. Spermatozoanın, DNA'nın rolünü incelemek için ideal bir model sistemi temsil ettiğini fark etmişti, çünkü daha sonra ifade edeceği gibi, "[f] gerçek kimyasal-biyolojik problemler için, spermin [hücrelerin] en büyük avantajı, her şeyin indirgenmiş olmasıdır. gerçekten aktif maddelere ve onların en büyük fizyolojik fonksiyonlarını gösterdikleri anda yakalandıklarına” (Miescher, 1893a). Verilerinin hala eksik olduğunu takdir etti, ancak sonuçlarını bir araya getirmek ve döllenmeyi açıklamak için daha geniş bir resme entegre etmek için ilk girişimi yapmak istedi.

O sıralarda, Wilhelm Kühne (1837–1900), diğerlerinin yanı sıra, spermatozoanın kimyasal özellikleri aracılığıyla döllenmeyi sağlayan belirli maddelerin taşıyıcıları olduğu fikrini ortaya atıyordu (Kühne, 1868). Miescher, spermatozoanın kimyasal bileşimine ilişkin sonuçlarını bu bağlamda değerlendirdi. Döllenmeyi açıklayan bir kimyasal maddenin olasılığını eleştirel olarak değerlendirirken, şunları söyledi: Döllenme konusunda, şüphesiz, her şeyden önce Nuclein'i düşünmeliyiz. Nüklein gövdelerinin [spermatozoanın] ana bileşenleri olduğu tutarlı bir şekilde bulundu” (Miescher, 1874).

Geriye dönüp bakıldığında, bu ifadeler Miescher'in nükleini döllenmeye aracılık eden molekül olarak tanımladığını gösteriyor gibi görünmektedir - kalıtımdaki rolünü takip etmek için çok önemli bir varsayım. Ne yazık ki, Miescher'in kendisi bundan bir molekülün (veya moleküllerin) sorumlu olduğuna ikna olmaktan çok uzaktı. Her ne kadar genç Miescher'in biyokimyaya olan ilgisini teşvik etmede aracı olan ve hayatı boyunca güçlü bir etki olarak kalan amcasının etkisi büyük olasılıkla çok önemli bir faktör olsa da, isteksizliğinin birkaç nedeni var. Gerçekten de, Miescher DNA'nın işlevini ortaya çıkarmaya cesaret verici bir şekilde yaklaştığında, His'in görüşleri ters etki yaptı ve muhtemelen onun bulgularını o sırada diğer bilim adamlarından elde edilen yeni sonuçlar bağlamında yorumlamasını engelledi. Böylece Miescher, nüklein ve onun döllenme ve kalıtımdaki işleviyle ilgili çalışmalarını bir sonraki düzeye taşıyamadı, bu da DNA'nın her iki süreçte de merkezi molekül olarak tanınmasıyla sonuçlanabilirdi.

Miescher'i döllenmede nükleinin rolünü düşünmekten alıkoyan spesifik bir yön, tavuk oositlerindeki yumurta sarısı trombositlerini çok sayıda nüklein içeren granüller olarak hatalı bir şekilde tanımladığı önceki bir çalışmaydı (Miescher, 1871b). Bu onu, zaten çok daha fazla madde içeren bir oosite bir spermatozoadan alınan DNA'nın nispeten minimal niceliksel katkısının, sonrakinin fizyolojisi üzerinde önemli bir etkisi olamayacağı sonucuna varmasına yol açtı. Bu nedenle, “döllenmenin gizemi belirli bir maddede gizlenemez. […] Bir parça değil, bütün, tüm parçalarının işbirliğiyle hareket etmelidir” (Miescher, 1874).

Miescher'in oositlerdeki yumurta sarısı trombositlerini nüklein içeren hücreler olarak tanımlaması daha da talihsiz bir durumdur, çünkü bu granüllerdeki varsayılan nükleinin, daha önce diğer kaynaklardan izole ettiği nükleinden (yani DNA'dan) farklı olduğunu fark etmişti. çok daha yüksek fosfor içeriği ile. Ancak His'in bu yapıların gerçek hücreler olduğuna dair güçlü görüşünden etkilenen Miescher, sonuçlarını bu ışıkta gördü. Sadece birkaç yıl sonra, çağdaşları Flemming ve Eduard A. Strasburger'in (1844–1912) çekirdeklerin morfolojik özellikleri ve hücre bölünmeleri sırasındaki davranışları hakkındaki sonuçlarına ve Albrecht Kossel'in (1853–1927) DNA'nın bileşimi hakkındaki keşiflerine dayanarak ( Portugal & Cohen, 1977), Miescher, tavuk oositlerinin çok sayıda nüklein içeren granül içerdiğine dair ilk varsayımını revize etti mi? Bunun yerine, sonunda bu granülleri içeren moleküllerin nükleinden farklı olduğunu kabul etti (Miescher, 1890).

Miescher'in kalıtsal özelliklerin aktarımının temeli olduğu sonucuna varmasını engelleyen bir başka faktör de, tek bir maddenin kalıtsal özelliklerin çokluğunu nasıl açıklayabileceğini kavrayamamasıydı. Belirli bir molekülün türler, ırklar ve bireyler arasındaki farklılıklardan nasıl sorumlu olabileceğini merak etti. Her ne kadar “bu moleküllerin [farklı nüklein türleri] kimyasal yapısındaki farklılıkların meydana geleceğini, ancak yalnızca sınırlı bir ölçüde” kabul etmesine rağmen (Miescher, 1874).

Ve böylece, moleküllere bakmak yerine, tıpkı His amcası gibi, sperm hücrelerinin fiziksel hareketinin veya bir kasın nöronal uyarılarla uyarılmasına benzettiği oosit aktivasyonunun sorumlu olduğu fikrini tercih etti. Döllenme süreci için: “Sinirinin aktivasyonu sırasındaki kas gibi, oosit de uygun uyarıları aldığında kimyasal ve fiziksel olarak çok farklı bir varlık haline gelecektir” (Miescher, 1874). Miescher, nükleinin kendisi için, o sırada bilinen yüksek fosfor içeriğine sahip birkaç diğer molekülden biri olan lesitin gibi diğer moleküller için bir kaynak malzeme olabileceğini düşündü (Miescher, 1870, 1871a, 1874). Miescher, nüklein fikrini, bu tür materyalleri sentezlemek için bilgiyi kodlamada rolü olan bir molekülden ziyade, hücre için materyal (çoğunlukla fosfor) için bir depo olarak açıkça tercih etti. Büyük moleküllerin daha küçük olanlar için kaynak materyal olduğu fikri o zamanlar yaygındı ve proteinler için de düşünülmüştü (Miescher, 1870).

Miescher'in 1874 tarihli makalesinin nükleinin fizyolojik rolünü tartıştığı bölümünün tamamı, sanki nükleinin döllenme ve kalıtımda anahtar molekül olduğuna karşı kasıtlı olarak kanıt toplamaya çalışıyormuş gibi okunur. Kendisinin keşfettiği moleküle yönelik bu aşağılayıcı yaklaşım, en azından bir dereceye kadar, sonuçlarını o kadar eleştirel bir şekilde görme eğilimiyle açıklanabilir ki, yaklaşık otuz yıla yayılan bir kariyerde sadece 15 makale ve ders yayınladı.

Döllenmenin iki germ hücresinin kaynaşmasıyla elde edildiğine dair modern anlayış, ancak on dokuzuncu yüzyılın son çeyreğinde yerleşmiştir. O zamandan önce, hemen hemen her yerde bulunan görüş, sperm hücresinin sadece yumurta ile temas yoluyla, bir şekilde oositin gelişmesini teşvik ettiğiydi -fizikselci bakış açısı. O, bu görüşün önemli bir savunucusuydu ve belirli bir maddenin kalıtıma aracılık edebileceği fikrini kesin olarak reddetti. O sırada farklı bir entelektüel ortamda çalışsaydı, ya da sonuçlarının yorumlanmasında daha bağımsız olsaydı, Miescher'in sonuçlarını nasıl yorumlayacağı konusunda ancak tahminde bulunabiliriz.

O sırada farklı bir entelektüel ortamda çalışsaydı, Miescher'in sonuçlarını nasıl yorumlayacağı konusunda ancak tahminde bulunabiliriz…

Miescher'in nükleini döllenme ve kalıtımın anahtarı olarak kabul etmeyi reddetmesi, 1870'lerin ortalarında ortaya çıkan ve bilim adamlarının dikkatini çekirdeklere odaklayan birkaç çalışma göz önüne alındığında özellikle trajiktir. Leopold Auerbach (1828-1897), döllenmiş yumurtaların birbirine doğru hareket eden ve embriyonun sonraki gelişiminden önce kaynaşan iki çekirdek içerdiğini gösterdi (Auerbach, 1874). Bu gözlem, çekirdeklerin döllenmede önemli bir rol oynadığını kuvvetle ortaya koydu. Daha sonraki bir çalışmada, Oskar Hertwig (1849–1922), biri sperm hücresinden diğeri oositten gelen iki çekirdeğin, embriyogenez başlamadan önce kaynaştığını doğruladı. Ayrıca, embriyodaki tüm çekirdeklerin zigottaki bu ilk çekirdekten türediğini gözlemledi (Hertwig, 1876). Bununla tek bir spermin oositi döllediğini ve gelişim boyunca zigottan sürekli bir çekirdek soyunun olduğunu tespit etmişti. Bunu yaparken, fizikalist gübreleme görüşüne öldürücü darbeyi indirdi.

1880'lerin ortalarına gelindiğinde, Hertwig ve Kölliker, çekirdeğin kalıtıma aracılık eden en önemli bileşeninin nüklein olduğunu zaten varsaymışlardı - bu fikir daha sonra birkaç bilim adamı tarafından kabul edildi. Ne yazık ki, Miescher 1895'teki ölümüne kadar şüpheli kaldı ve bu nedenle keşfinin gerçek önemini takdir edemedi. Bu, diğerlerinin sperm başlarının homojen bir maddeden oluştuğuna dair iddialarına aşırı tepki olabilirdi, Miescher, proteinler gibi başka moleküller de içerdiğini açıkça göstermiştir. Dahası, Miescher'in nükleinin sadece sperm başının dış kabuğunda meydana geldiğine dair hatalı varsayımı, kafaların merkezlerini boyayan kromatin lekelerinin aslında nükleinin bulunduğu bölgeyi işaret ettiğini fark edememesine neden oldu. tüm sperm başı, nüklein ve ilişkili proteinden oluşur (Miescher, 1892a Schmiedeberg & Miescher, 1896).

Ne yazık ki, sadece Miescher değil, tüm bilim camiası, kalıtımın aracılık eden molekül olarak DNA'ya olan inancını kısa sürede kaybedecekti. Miescher'in çalışması DNA'yı tüm hücrelerin çok önemli bir bileşeni olarak belirlemiş ve diğerlerine DNA'nın kalıtımdaki rolünü keşfetmeye başlamaları için ilham vermişti, ancak yirminci yüzyılın başında tetranükleotid hipotezinin ortaya çıkmasıyla DNA gözden düştü ve yerini proteinler aldı. Bu işlev için ana adaylar. DNA'nın her biri dört bazın tümünü içeren özdeş alt birimlerden oluştuğunu varsayan tetranükleotid hipotezi, 1940'ların sonlarına kadar Edwin Chargaff'ın (1905–2002) DNA'daki farklı bazların eşmolar miktarlarda bulunmadığını keşfetmesine kadar geçerliydi (Chargaff). ve diğerleri, 1949, 1951 ).

Ne yazık ki, sadece Miescher değil, tüm bilim camiası, kalıtımın aracılık eden molekül olarak DNA'ya olan inancını kısa sürede kaybedecekti.

Sadece birkaç yıl önce, 1944'te Avery ve meslektaşları tarafından yapılan deneyler, DNA'nın bakterileri dönüştürmek için yeterli olduğunu göstermişti ( Avery ve diğerleri, 1944 ).Daha sonra 1952'de Al Hershey (1908–1997) ve Martha Chase (1927–2003), viral DNA'nın (ancak hiçbir proteinin) bakterilere T2 bakteriyofajı ile enfeksiyon sırasında girdiğini ve bu DNA'nın aynı zamanda bakteride de bulunduğunu gözlemleyerek bu bulguları doğruladı. enfekte bakteriler tarafından üretilen yeni virüsler (Hershey & Chase, 1952). Son olarak, 1953'te DNA'nın X-ışını görüntüleri Watson ve Crick'in DNA'nın yapısını anlamasını sağladı (Watson & Crick, 1953) ve böylece DNA'nın nasıl çalıştığını anlamamızı sağladı. Daha da önemlisi, bu deneyler, bakteriyoloji ve virolojideki ilerlemelerin yanı sıra, proteinlerin ve nükleik asitlerin radyoaktif etiketlenmesi ve X-ışını kristalografisi gibi yeni tekniklerin geliştirilmesiyle mümkün olmuştur - bunlar, Miescher ve onun ulaşamayacağı kaynaklardır. çağdaşlar.

Daha sonraki yıllarda (Şekil 5), Miescher'in dikkati, nükleinin döllenme ve kalıtımdaki rolünden kademeli olarak, kas pahasına büyük miktarlarda germ hücresi üretirken somonun vücutlarındaki metabolik değişikliklerle ilgili olanlar gibi fizyolojik sorulara kaydı. doku. Fizyolojinin farklı alanlarına önemli ve ufuk açıcı katkılarda bulunmasına rağmen, en umut verici araştırma alanı olan DNA'nın işlevini keşfetmeyi giderek ihmal etti. Ancak yaşamının sonlarına doğru bu soruya geri döndü ve konuyu yeni bir ışık altında yeniden düşünmeye başladı, ancak daha fazla ilerleme kaydetmedi.

Bununla birlikte, ilgi çekici hipotezler önerdiği alanlardan biri - onları destekleyecek deneysel veriler olmamasına rağmen - kalıtımın moleküler temelleriydi. Darwin'in bitkilerde döllenme üzerine çalışmasından ilham alan Miescher, örneğin bilginin biyolojik moleküllerde nasıl kodlanabileceğini öne sürdü. “Benim için cinselliğin anahtarının stereokimyada yattığını” belirtti ve Darwin'in pangenesis teorisinin mücevherlerinin muhtemelen “organik maddelerde bulunan çok sayıda asimetrik karbon atomu” (Miescher, 1892b) olduğuna dair inancını açıkladı. ve cinsel üreme, onların "stereometrik mimarisindeki" hataları düzeltmek için işlev görebilir. Bu nedenle, Miescher, kalıtsal bilgilerin makromoleküllerde kodlanabileceğini ve hataların nasıl düzeltilebileceğini öne sürdü; bu, kulağa esrarengiz bir şekilde, şu anda haploid eksikliklerin vahşi tip aleller tarafından tamamlanması olarak bilinen şeyi tahmin etmiş gibi geliyor. Mendel, çekinik özelliklerin kalıtım yasalarını 25 yıldan daha uzun bir süre önce yayınlamış olduğundan, Miescher'in durumun böyle olduğunu düşünmüş olabileceğini varsaymak özellikle caziptir. Ancak, Miescher'in bize bıraktığı gazetelerde, konuşmalarda veya mektuplarda Mendel'in çalışmalarına atıfta bulunulmamaktadır.

Miescher, kalıtsal bilgilerin makromoleküllerde kodlanabileceğini ve hataların nasıl düzeltilebileceğini öne sürdü…

Bildiğimiz şey, Miescher'in kalıtsal bilginin makromoleküllerde nasıl depolanabileceğine ilişkin görüşünü ortaya koyduğudur: "Muazzam protein moleküllerinde […] tüm dillerin kelime ve terimlerinin alfabenin 24-30 harfinde yaptığı gibi, kalıtsal [özellikler] aktarımı onlarda ifadesini bulabilir. Bu nedenle sperm hücresini veya oositi, her biri özel bir kalıtsal özelliğin (de Vries Pangenesis) taşıyıcısı olması gereken sayısız kimyasal madde deposu olarak görmek tamamen gereksizdir. Çalışmalarımın gösterdiği protoplazma ve çekirdek, sayısız kimyasal maddeden değil, çok az sayıda kimyasal bireyden oluşur, ancak belki de çok karmaşık bir kimyasal yapıya sahiptir” (Miescher, 1892b).

Bu, Miescher'in yazılarında dikkate değer bir pasajdır. On dokuzuncu yüzyılın ikinci yarısı, kalıtsal özelliklerin nesiller arasında nasıl aktarıldığına dair yoğun spekülasyonlara sahne oldu. Konsensüs görüşü, hem embriyonik gelişimi şekillendirdiği hem de kalıtıma aracılık ettiği düşünülen küçük parçacıkların dahil olduğunu varsayıyordu (Mayr, 1982). Miescher bu görüşe karşı çıktı. Her biri belirli bir özellikten (veya özelliklerden) sorumlu olabilen çok sayıda bireysel parçacık yerine, sonuçları, örneğin sperm hücrelerinin başlarının yalnızca çok az sayıda bileşikten, özellikle DNA ve ilişkili proteinlerden oluştuğunu göstermiştir. .

Kalıtsal bilginin büyük moleküllerde nasıl depolanabileceğine dair teorisini daha da detaylandırdı: “Süreklilik sadece biçimde değil, aynı zamanda kimyasal molekülden daha derinde yatıyor. Atomların kurucu gruplarında bulunur. Bu anlamda, kimyasal bir kalıtım modeline bağlıyım. à çıkış [son derece]” (Miescher, 1893b). Bu ifadeyle Miescher, germ hücreleri aracılığıyla iletilen herhangi bir ön oluşum veya bazı morfolojik süreklilik fikrini kesin olarak reddeder. Bunun yerine, ancak çok daha sonra bilinecek olanı açıkça öngörmüş görünüyor: kalıtımın temeli, moleküllerin kimyasal bileşiminde bulunacaktı.

Bunun nasıl başarılabileceğini açıklamak için, bilginin bir makromolekülde nasıl kodlanabileceğine dair bir model önerdi: “Kolaylıkla mümkün olduğu gibi, bir protein molekülü 40 asimetrik karbon atomu içeriyorsa, 2 40 , yani yaklaşık olarak bir protein molekülü olacaktır. trilyon izomerizm [sic]. Ve bu, [nitrojen gibi diğer atomları hesaba katmadan] olası izomerizm türlerinden yalnızca biridir. Kalıtım teorisinin gerektirdiği hesaplanamaz çeşitliliği elde etmek için teorim diğerlerinden daha uygundur. Görünmezden en büyük farklılıklara kadar her türlü geçiş düşünülebilir” (Miescher, 1893b).

Miescher'in kalıtsal özelliklerin nasıl iletilebileceği ve kodlanabileceğine ilişkin fikirleri, o zamandan beri doğruluğu kanıtlanmış birçok önemli kavramı kapsar. İlk olarak, eşeyli üremenin hataları veya bugün adlandırdığımız şekliyle mutasyonları düzeltmeye hizmet ettiğine inanıyordu. İkincisi, kalıtsal özelliklerin aktarımının, o zamanlar düşünüldüğü gibi, her biri tek özellikleri kodlayan çok sayıda ayrı molekülden ziyade, bilgiyi kodlayan karmaşık kimyasal bileşimlere sahip bir veya birkaç makromolekül aracılığıyla gerçekleştiğini öne sürdü. Üçüncüsü, bilginin bu moleküllerde şaşırtıcı derecede fazla sayıda olası kalıtsal özellik ile sonuçlanan basit bir kod aracılığıyla kodlandığını ve böylece gözlemlenen türlerin ve bireylerin çeşitliliğini açıkladığını öngördü.

Miescher'in kalıtsal özelliklerin nasıl iletilip kodlanabileceğine ilişkin fikirleri, o zamandan beri doğru olduğu kanıtlanmış birçok önemli kavramı kapsar.

Miescher'in DNA veya diğer makromoleküllerin ne yaptığını veya kalıtsal bilgilerin nasıl depolandığını anladığını öne sürmek çok uzak bir adımdır. Zamanının bağlamı göz önüne alındığında, bunu yapamazdı. Günümüze güzel bir şekilde uyan ve çoğu zaman modern anlayışımızı öngören bulguları ve hipotezleri, muhtemelen Miescher ve çağdaşlarına oldukça ayrık geldi. Onun zamanında, pek çok gerçek hâlâ kuşkuluydu ve pek çok bağlantı zayıftı. Bugünün ışığında uzun zaman önce yapılmış spekülasyonları ve hipotezleri aşırı yorumlama tehlikesi her zaman vardır. Bununla birlikte, Miescher bazı bulgularını yanlış yorumlamış olsa da, vardığı sonuçların büyük bir kısmı, şu anda doğru olduğunu bildiğimiz şeye şaşırtıcı bir şekilde yaklaştı. Dahası, çalışmaları diğerlerini DNA ve işlevi hakkında kendi araştırmalarını sürdürmeleri konusunda etkiledi (Dahm, 2008). DNA araştırması on dokuzuncu yüzyılın sonundan birkaç on yıl sonra modası geçmiş olsa da, Miescher ve çağdaşları tarafından derlenen bilgiler, yirminci yüzyılın ortalarında gerçekleştirilen ve DNA'nın işlevini açık bir şekilde ortaya koyan belirleyici deneylerin temelini oluşturdu. .

Bu nedenle, Miescher'in kariyerinin belki de en trajik yönü, diğerlerinin yanı sıra His ve Ludwig tarafından ileri sürüldüğü gibi, yaşamının büyük bir bölümünde fizikselci gübreleme teorilerine sıkı sıkıya inanması ve titiz kimyasal analizlerinden elde ettiği sonuçları, diğerleriyle birleştirme konusundaki isteksizliğiydi. sitologlar ve histologlar tarafından üretilen 'daha yumuşak' veriler. Nüklein ve kromozomlar arasındaki bağlantıyı kurmuş ve onun döllenme ve kalıtımdaki anahtar rolünü kabul etmiş olsaydı, keşfettiği molekülün hayatın en büyük gizemlerinden bazılarının anahtarı olduğunu anlayabilirdi. Olduğu gibi, gerçek anlamda katkıları çağdaşlarının çoğunu gölgede bırakacakken, umut verici bir kariyerin gerçekleşmediği duygusuyla öldü (His, 1897).

…gerçekte katkıları çağdaşlarının çoğunu gölgede bırakacakken […]

Miescher'in araştırmalarının - ve bir bütün olarak biyolojinin - biraz farklı koşullar altında izlemiş olabileceği yolu tahmin etmek cesaret vericidir. Hücre çoğalması gibi farklı fizyolojik koşullarda DNA'nın rolüyle ilgili ön sonuçlarını izleseydi ne olurdu? Oositte kendisine çok sayıda küçük çekirdek gibi görünen şeyin yanlış tanımlanmasıyla yanıltılmasaydı, döllenme ve kalıtımla ilgili teorileri nasıl değişirdi? Ya da amcasının görüşlerinden değil, aynı zamanda daha geniş bilimsel kuruluşun görüşlerinden de etkilenmemiş olsaydı, nükleinle ilgili bulgularını nasıl yorumlayacaktı?

Friedrich Miescher'in hayatında ve çalışmalarında, anlık başarılarının ve başarısızlıklarının ötesine geçen daha genel bir ders var. Hikayesi, yenilikçi deneysel yaklaşımlar geliştiren, sorularına cevap vermek için doğru biyolojik sistemleri seçen ve çığır açan keşifler yapan, yine de entelektüel çevresi tarafından kısıtlanan ve bu nedenle bulgularını objektif olarak yorumlaması engellenen parlak bir araştırmacının hikayesidir. Bu nedenle, önemli çıkarımları yapmak ve böylece DNA'nın işlevini kurmak, onun çalışmasına yeni bir bakış açısıyla bakan başkalarına düştü.


MİKROBİAL DÜNYA: TARİHİ BİR PERSPEKTİF

Tahmin edebileceğiniz gibi, bu hikaye çok özetlenmelidir çünkü DNA'nın moleküler yapısını ve hareket tarzını çözmekle yakından ilgilenen insanların sayısı gerçekten çok fazladır. Ama her şeye rağmen harika bir hikaye yaratıyor.

Friedrich Miescher, 1869'da DNA'yı keşfettiğinde 25 yaşındaydı ve

tamamen bilinmiyor. Hücrenin çekirdeğinde bulunan DNA'yı keşfetti. Çekirdeğin benzersiz bir kimyasal bileşime sahip olabileceğini ve önemli bir işlevi olabileceğini öne sürdü. Ve bu, çoğu araştırmacının çekirdeğin benzersiz olmadığına ve nispeten önemsiz bir hücre yapısı olduğuna inandığı bir zamandaydı.

1866'da, zamanın saygın bir anatomisti olan Ernst Haeckel, hücre yapısıyla ilgili olarak hemen ciddiye alınan bazı oldukça derin açıklamalar yaptı. Çekirdeğin kalıtsal karakterlerin iletilmesini sağladığını, dış plazmanın ise dış dünyaya uyum veya uyum sağladığını söyledi. Bundan sonra dikkat çekirdeğe, kimyasının doğasına ve işlevinin doğasına odaklanmaya devam etti.

Yaklaşık 1909'dan 1940'ların başlarına kadar uzun yıllar süren sert kimya ve çok tartışmadan sonra, dört nükleotit bazının, ATGC'nin nükleik asitlerde eşit oranlarda mevcut olduğu neredeyse tartışmasız bir dogmaydı. Modern bilimin makinelerinde teknolojik ilerlemenin hala çok uzakta olduğunu unutmayın. Nükleik asitlerdeki bazların eşit miktarları fikri, nükleik asitlerin yapısı için tetranükleotid hipotezi olarak bilinen şeyin formülasyonuna yol açtı. Bu, daha karmaşık teknikler kullanan daha rafine çalışmalar, DNA'nın moleküler ağırlığının bir milyon veya daha fazla olduğunu, oysa bir tetranükleotidin moleküler ağırlığının 10.000'den az olduğunu gösterdiğinde gündeme geldi. Ancak DNA için iyi anlaşılmış veya genel kabul görmüş bir işlev yoktu.

Hikayeye devam etmek için 1800'lerin ortalarında bahçede çiftleşme bezelyeleriyle oynamaktan zevk alan bir keşiş olan Gregor Mendel ile başlayacağız. Uzun ve karmaşık bir hikayeyi özetlemek gerekirse, bu cinsel birlikteliklerin eve götürdüğü mesaj, bitkilerin ve genel olarak tüm canlıların fiziksel özelliklerini yavrularına aktardıkları bir mekanizmanın var olduğuydu. Biz bu mekanizmaya kalıtım diyoruz ve bu sadık aktarım tarafından gerçekleştirilir ve görünen ve görünmeyen tüm özelliklerinizi kodlayan genlerin yavrularınıza sadık, yani kesin aktarımının altını çiziyorum. Genleriniz kim olduğunuzu söylüyor. Elbette, Nurture nihai sonucumuzda büyük bir rol oynuyor, ancak bunu hikayemizde göz ardı edeceğiz. Mikrobiyolojinin DNA ve kalıtım hikayesinde büyük bir yeri olduğunu söylemekten büyük gurur duyuyorum.

Hikayedeki bir sonraki kahramanımız, evrim teorisini öneren bir biyolog olan Charles Darwin'dir. Temel olarak Darwin'in belirttiği şey, evrimi yönlendiren doğal gücün varoluş mücadelesi olduğuydu. Thomas Malthus, doğal popülasyonların besleyebileceklerinden daha fazla birey ürettiğini söylemişti. Yiyecek rekabeti daha sonra rekabet etme yeteneği en düşük olanların ölümüyle sonuçlandı. Bundan Darwin, mevcut dış koşullara en çok uyum sağlayabilen organizmaların hayatta kalma ve üreme olasılığının en yüksek olduğu sonucuna vardı. Hayatta kalmak için avantaj sağlayan şans varyasyonları üreme yoluyla korundu, dezavantajlı olanlar organizmaların ölümü sonucunda ortadan kayboldu. Uzun zaman dilimleri içinde bu bitmez tükenmez süreç yeni çeşitler ve yeni türler doğurdu.

Bu teoriyi kullanarak moleküler düzeyde nasıl bu kadar benzer olduğumuzu açıklayabiliriz, ancak bir grup olarak maymunlardan tavuklara, karıncalardan solucanlara kadar çok çeşitli fiziksel özelliklere sahip olabiliriz. Moleküler düzeyde birbirimize benziyoruz çünkü genlerimizin büyük bir yüzdesini diğer hayvanlar ve bitkilerle paylaşıyoruz. Yüksek maymunlara o kadar benziyoruz ki, %97 veya daha fazla DNA homolojisi paylaşıyoruz, bu da genlerimizin son derece benzer ve birçok durumda özdeş olduğu anlamına geliyor. Bu, çağlar boyunca evrimleşen ve nihayetinde bugün dünyada var olan çok sayıda biyolojik tipe yol açan ilkel bir hücreden doğduğumuzu fark ettiğimizde kolayca anlaşılır. Zaman kalırsa, bu ilginç konuya kursun ilerleyen bölümlerinde dönebiliriz.

Şimdi, eğer tüm canlılar tek bir ilkel hücreden ortaya çıktıysa, moleküler düzeyde neden bu kadar benzer olmamız gerektiği anlaşılabilir. Evrim sürecinde ebeveynlerimizin tüm genlerini miras alıyoruz. Bu genler değişimden geçiyor, biz onlara mutasyon diyoruz ve biz evrim sürecinden geçerken yeni genler ortaya çıkıyor. Evrimle, çevredeki herhangi bir değişikliğe uyum sağlayan en uygun formun seçiminden başka bir şey kastetmiyorum. Hayatta kalacak ve diğer tüm formlardan daha uzun yaşayacak olanın yalnızca en uygun formlar olması mantıklıdır. Örnek olarak mevcut küresel ısınma sorunumuzu ele alalım. Sadece daha yüksek sıcaklıklarda tolere edebilen ve çoğalabilen formlar hayatta kalacaktır. Diğerleri yok olacak.

Listemde sıradaki kişi bir İngiliz, Fred Griffith, İngiliz Sağlık Bakanlığı'nın patoloji laboratuvarında çalışan bir sağlık memuru. 1920'lerde zatürreye neden olan organizmadaki virülansın transferi üzerinde çalışan bir mikrobiyologdu. Pnömokokların Pürüzsüz ve Kaba formlarını tanımlayan ve bunları virülansla ilişkilendiren ilk kişidir. Virülans ile bir organizmanın insanda hastalığa neden olma yeteneğini kastediyorum. Bakteriyel pnömoni etkeni olan pnömokokların özelliklerinden biri, pnömonili hastaların balgamında bulunan organizmaların hücre duvarını kaplayan bir kapsüle sahip olmasıdır. Hücreler çok düzgün koloniler oluşturduğundan, Petri plakalarında bir kapsülün varlığının saptanması kolaydır. Görünüm olarak tereyağlı olarak adlandırılırlar. Bir kapsül ayrıca, özellikle boyamadan sonra, mikroskopta hücreler üzerinde kolayca görülebilir. Bu kapsül, farklı pnömokok suşları arasında kimyasal bileşimde değişkendir ve bu farklı kapsüler tipler olarak adlandırılanlar, basit serolojik yollarla ayırt edilebilir ve Romen rakamlarıyla gösterilir.

Griffith'in pnömokokların S ve R formlarını keşfetmesi 1923'te yapıldı. Farelere çok sayıda avirülent R hücresi enjekte edildiğinde, tamamen virülan olan S hücrelerinin geri kazanılmasının genellikle mümkün olduğu şeklindeki temel gözlemi yaptı. R hücrelerinin türetildiği ile aynı kapsül tipi. Virülans karakterinin korunduğu, ancak R hücrelerinde ifade edilmediği ve hayvan vücudunun sadece S formlarının çoğalabileceği seçici bir ortam görevi gördüğü sonucuna varmıştır. Pek çok deneyden sonra, S & R varyasyonunun tersine çevrilebilir bir mutasyonel değişiklik olduğu sonucuna vardı.

Griffith, kapsül tiplerinin virülanstaki rolüyle ilgilendi. Kapsül tip III pnömokok suşundan kaynaklanan bir pürüzsüz veya S suşu seri olarak alt kültürlendiğinde, yani bir büyüme plakasından taze olana aktarıldığında, plaka üzerinde R olarak adlandırılan kaba bir koloninin ara sıra görüneceğini gözlemledi. Bu koloniyi oluşturan hücreler kapsülden yoksundur ve bu da koloniyi sertleştirir. Ve R kolonileri doğrudur, yani her zaman R kolonilerine yol açmışlardır. Ancak hepsinden daha ilginç olanı, bu R hücreleri avirülenttir, fareleri öldürmezler, oysa kaynaklandıkları S düz hücreleri öldürür.

1928'de Fred Griffith şaşırtıcı bir gözlem yaptı. Pürüzsüz tip I'den türetilen çok sayıda R hücresi, ısıyla öldürülen S tip II ile birlikte bir farenin derisinin altına aşılandığında, fare birkaç gün içinde öldü. Sadece ısıyla öldürülen S tip II alan fareler hayatta kaldı. Sadece R hücrelerini alan fareler de hayatta kaldı. Ölü farelerden alınan kan sadece S tip II hücreleri verdi. Ancak hayvana aşılanan tip II düz hücrelerin ısıyla öldürüldüğünü unutmayın, bu nedenle yeni tip II S hücrelerinin kaynağı bu değildi. Birçok kontrol deneyinden sonra, ölü tip II hücrelerin, R hücrelerine yeni bir tür kapsül yapma yeteneği veren bir şey salgıladığı sonucuna vardılar. Aktarılan mülkün kalıtsal olduğunu keşfettiler, böylece yeni bir tür oluşturdular. Genetik materyalin bir mikrobiyal hücreden başka bir hücreye transferine Dönüşüm adını verdiler. Şimdi unutmayın, bakterilerde genetik materyal aktarımının tarihte ilk kez görüldüğünü unutmayın. Bu olasılığı kimse düşünmemişti bile. Muhteşemdi.

Diğerleri resme girdi ve aynı kapsül tipi dönüşümü in vitro, test tüpünde, sadece ısıyla öldürülen tip II S hücrelerini R tip I S ile karıştırarak ve karışımı kaplayarak elde edebileceklerini buldu. Yine de diğerleri, R alıcı hücreleri ile ısıyla öldürülen S hücrelerinin hücre içermeyen ekstraktlarını karıştırarak transformasyon deneyini yapabileceklerini gösterdi. Açıkça görülüyor ki, bu hücresiz ekstrakte bir gen gibi davranan, yani kalıtsal karakterleri aktaran bir şey vardı. Bu şeye Dönüşen İlke adı verildi.

1944'te Ostwald T. Avery, Colin MacLeod ve Maclin McCarty, New York'taki Rockefeller Enstitüsü'nde çalışan üç mikrobiyolog, pnömokoktan dönüştürme prensibini saflaştırmayı başardılar ve onun yalnızca DNA'dan oluştuğunu buldular. Bu biraz sapkındı çünkü o zamana kadar bir hücrede bir gen gibi davranacak kadar karmaşık olan tek şeyin protein olduğuna inanılıyordu.Görüyorsunuz, nükleik asitlerin A, T, G, C olmak üzere yalnızca dört bileşen alt birimi vardır, bu nedenle tetra nükleotidler içindeki varyasyon olasılıklarını sınırlarken, proteinler 20'den fazla farklı amino asitten oluşturulabilir, bu da sonsuz bir olasılık olasılığını ortaya çıkarır. yapıdaki olası permütasyonların sayısı ve dolayısıyla sınırsız sayıda gen. Her halükarda, hikayeye göre, bu adamlar New York'taki Rockefeller Enstitüsü'nde çalışmamış olsaydı, Dönüştürme İlkesini karakterize etmede başarılı olamayacaklardı. Görüyorsunuz, Rockefeller çok samimi ve samimi bir yer ve herkes herkesin ne yaptığını biliyor. Proteinleri spesifik olarak parçalayan bir enzim olan Pepsin, yakın zamanda orada saflaştırılmıştı. Bu saf pepsinin bir kısmı Avery'ye verildi ve ona, "İşte bu, dönüşüm prensibinizi bozacak" denildi. Böylece Avery, pepsin ile inkübe ederek ve ardından bir dönüşüm deneyinde deneyerek yarı saflaştırılmış dönüştürme ilkelerini bozmaya çalıştı. Eh, enzim dönüştürme ilkesini bozmadı. Böylece, dönüşüm ilkelerini bozacak başka enzimler aramaya başladılar. Ribonükleik asidi spesifik olarak parçalayan bir enzim olan ribonükleaz, transformasyon prensibi üzerinde bir etkiye sahip değildi. McCartyi, DNA'yı parçalayan enzim olan DNAaz'ı saflaştırdı ve transformasyon elimine edildi. DNAaz'ın dönüşüm ilkelerini bozacağını buldu. Dönüştürme ilkesini saflaştırmayı başardılar ve DNA'dan oluştuğunu buldular. Biyolojik aktivitesi o kadar büyüktü ki, reaksiyon sisteminde 100.000.000'de 1'den daha az bir son seyreltmede kullanıldığında bile transfromasyon sağlayabiliyordu.

Kağıt büyük beğeni ile karşılanmadı. Birincisi, mikrobiyolojik veya biyokimyasal bir dergide değil, tıp dergisinde yayınlandı. Hepsinden önemlisi, insanlar DNA kadar basit bir molekülün bir hücredeki binlerce proteini kodlamak için yeterli esnekliğe sahip olabileceğine ikna olmadılar. Sadece proteinler bu kodlama potansiyelini içeriyordu. Yani Avery gazetesi büyük bir koku yapmadı.

Yine de, bazıları onu okudu ve kabul etti. Edwin Chargaff, Avery'nin makalesini okuduktan sonra tüm araştırma projesini nükleik asitleri incelemek üzere değiştirdi. Chargaff, DNA yapısıyla ilgili çok temel keşifler yaptı. Çeşitli omurgalılardan ve birçok bakteriden alınan DNA örneklerindeki dört nükleotidin nispi miktarlarını ölçmek için basit bir teknik kullandı. Bazı türler, adenin ve timinin baskın olduğu DNA'ya sahipken, diğerleri daha fazla guanin ve sitozin içeren DNA'ya sahipti. Böylece iki DNA molekülünün aynı bileşime sahip olmama olasılığı ortaya çıktı. Ayrıca, adenin konsantrasyonunun her zaman timinin konsantrasyonuna eşit olduğunu ve konsantrasyonda her zaman aynı olan guanin ve sitozin için aynı olduğunu gösterdi. Bu, Chargaff kuralı olarak bilinir hale geldi ve DNA modelinin oluşturulmasında muazzam bir öneme sahipti.

DNA'nın genetik rolü için evrensel kabulü kazanmak için Avery tarafından kullanılandan tamamen farklı bir biyolojik sistemle bir deney yapıldı. Alfred Hershey ve Martha Chase, DNA'nın genetik bilginin taşıyıcısı olduğunu kanıtlamak için bakteriyofaj veya kısaca faj adı verilen bakterileri enfekte eden bir virüs kullandılar. Çok kısaca, fajlar, yalnızca proteinden ve RNA veya DNA'dan oluşan, başka bir şey değil, bakteriye özgü virüslerdir. Şimdi, proteinler S elementini içerirken nükleik asitler S içermez ve nükleik asitler fosfor içerirken proteinler içermez. E. coli bakterisini enfekte eden Hershey ve Chase etiketli faj T2, ya T2 proteinlerine dahil olan radyoaktif S (S35) ya da T2'nin nükleik asidine giren radyoaktif fosfor (P32) ile. Daha sonra ayrı ayrı etiketlenmiş T2'yi E. coli ile inkübe ettiler, fajların bağlanması ve işlerini yapması için birkaç dakika beklediler ve ardından karışımı karıştırdılar ve serbest bırakılan faj gövdelerini santrifüj ettiler. Sadece P32 etiketli DNA'nın hücrelere girdiğini, S35 etiketli proteinin ise hücrelerin dışında kaldığını ve harmanlama yoluyla çıkarıldığını buldular. T2 faj soyu hücreler tarafından üretildiğinden, bu DNA'nın genetik materyal olduğunu kanıtlar.

Birkaç yıl sonra, o sırada UCLA'da Mikrobiyoloji profesörü olan Bob Romig, kattığı deneyi yaptı. DNA'yı bozulmamış bir B. subtilis fajı için, yani büyük bir dairesel molekül olarak izole etmek için çok zahmetli bir deney yaptı ve onu faj partiküllerinin patlamasına neden olan bir B. subtilis kültürünü dönüştürmek için kullandı.

Ve sonra 1953'te James Watson ve Francis Crick'in DNA'nın yapısıyla ilgili önerilerini içeren makale geldi. Bu makale çok önemlidir, çünkü genlerin nasıl çalıştığını, nasıl çoğaldıklarını ve nasıl değişebileceklerini kolayca ve çok kesin bir şekilde açıklar, bu mutasyondur. Muhtemelen 20. yüzyıldaki en önemli bilimsel çalışmadır. Biyoloji biliminin tüm tarihinde, yalnızca Darwin'in evrimin varlığını ve temel mekanizmasını kabul etmesi, keşfin önemine eşit olmuştur. Ve bunların hepsi Nature'daki bir gazetede bir sayfada söylendi.

Temel olarak DNA, bir çift sarmal oluşturan birbirine bağlı, özel olarak sıralanmış ATGC moleküllerinin iki muazzam uzun zincirinden oluşur. DNA, bir hücreyi oluşturmak ve onun sadık bir şekilde bölünmesini sağlamak için gerekli olan genetik bilgiyi yazmak için bir sözlük görevi görür. Bir proteindeki her amino asit için üçlü bir kod kullanır, yani genin nihai protein ürünündeki bir amino asidi kodlayan üç spesifik nükleotit. RNA'daki üçlü UUU'nun amino asit fenilalanin için kodlandığını ilk keşfeden, Ulusal Sağlık Enstitüleri'nde Marshall Nirenberg adlı genç bir biyokimyacıydı. Bu, DNA alfabesinin ilk harfiydi ve kalan üçlüler esas olarak Severo Ochoa ve Gobind Khorana ve olası tüm üçlü permütasyonlarda tanımlanmış ATG veya C yapısına sahip polimerleri sentezlemek için yöntemler geliştiren diğerleri tarafından tanımlandı. Bu çalışma o kadar önemliydi ki, Nirenberg ve Khorana 1968'de Nobel Ödülü'nü paylaştılar.

Bir kenara, DNA'nın kalıtımda herhangi bir rolü olduğu için her şeyin her zaman güllük gülistanlık olmadığını söylememe izin verin. Özellikle Wendell Stanley 1935'te tütün mozaik virüsünü kristalleştirdiğinde ve esas olarak daha az miktarda RNA içeren proteinden oluştuğunu keşfettiğinde. Ayrıca, virüsün protein yapısındaki değişiklikler keşfedildi, oysa nükleik asitlerdeki fosfor miktarları hemen hemen aynıydı, bu da protein değişirken sabit kaldığını düşündürdü. Bu nedenle, proteinlerin çeşitliliğinin, virüsün genlerini oluşturdukları anlamına geldiği düşünülmüştür.

DNA'nın replikasyonu, çift sarmalın Watson ve crick zincirlerinin ayrılması ve ardından iki özdeş çift sarmal veren iki ayrı sarmalın tamamlayıcı kopyalarının sentezi ile gerçekleşir. Molekülün tamamı kopyalandığında, bir sarmal yavru hücreye geçer ve diğeri anne ile geride kalır.

Size biyolojideki en güzel deney denen şeyi anlatayım. İki çok genç adam, biri doktora sonrası ve diğeri Oregon Eyalet Üniversitesi'nde yeni başlayan yardımcı doçent tarafından yapıldı. Deney, mucitlerin onuruna meselson, stahl deneyi olarak adlandırılır. Bu adamların yapmak istediği şey, Watson ve Crick tarafından önerilen dna replikasyonunun çift sarmalın iki ipliğinin ayrılmasını ve ardından bu iki ipliğin kopyalanmasını gerektirdiği fikrini test etmekti. Herkes tel ayırmanın bu kadar kolay olabileceğine ikna olmadı. Max Delbruck, DNA'yı açmanın düğümlere yol açabileceğini düşündü.

Meselson ve stahl, molekül ağırlıklarındaki hafif farklılıklara göre molekülleri ayırmalarına izin veren bir santrifüj tekniği kullandılar. bir merkezkaç dönüşün ardından, daha ağır moleküller, üste daha yakın kalan daha hafif olanlardan daha test tüpünün dibine daha yakın olur. Azot atomları dna'nın bir bileşeni olduğundan ve azot iki biçimde, ağır bir atom n15 ve doğal n14 olarak mevcut olduğundan, Meselson ve stahl, bakterileri n15 amonyum sülfatta büyüterek dna'larını n15 ile etiketleyebilirler. Tüm DNA'ları n15 ile etiketlenecek ve santrifüj tüpünde daha aşağıya göç eden ağır bir DNA bandı oluşturacaktır. Bu kültürden bir numune aldılar ve ortamı şimdi n14 amonyum sülfat içerecek şekilde değiştirdiler ve bir sonraki DNA replikasyonu turunun ışık n14'ü kullanmasını sağladılar. Watson ve Crick'in tahmin ettiği gibi sıkıştırmayı açma ve ardından kopyalama ise, o zaman deneydeki iki yeni oluşan DNA dizisi, bir ağır n 15 ebeveyn dizisinden ve bir hafif yeni oluşan n14 dizisinden oluşan hibrit yapılar olmalı ve DNA bandı, daha yükseğe göç etmelidir. Spinden sonra santrifüj tüpü. Kültürün daha fazla büyümesi, çift sarmallı DNA molekülünün sürekli olarak açılması ve kopyalanması ile sonuçlanır. Böylece üçüncü nesil tarafından, hibrit DNA bantlarının ayrılması ve kopyalanması, bir saf n14 çift sarmal ve bir hibrit sarmal ile sonuçlanacaktır. Bu n14 bandı, daha hafif olması nedeniyle tüpte hibridden daha da yükseğe taşınacaktır. Sanırım illustratoin bunu netleştirecektir.

Mutasyonlar, replikasyon işlemi sırasında DNA'da ara sıra bir hatanın dahil edilmesiyle meydana gelir, yani, kopyalanırken bir iplikte a yerine ag'nin eklenmesi, protein ürünündeki amino asitte bir değişikliğe yol açacaktır, böylece proteini değiştirmek ve muhtemelen işlevini etkilemek. Tüm mutasyonların zararlı olması gerekmez. Sadece proteinin fiziksel yapısını değiştiren mutasyonel değişiklikler onun işlevini etkileyecektir.

Görüyorsunuz ki, Watson-Crick DNA modeli, genlerin işleyişini ve bir bütün olarak kalıtım sürecini gerçekten açıklıyor. Kesinlikle nobel ödülüne değerdi.

Aynı kesin kalıtım mekanizması bakterilerde, babunlarda, papağanlarda, fillerde ve karıncalarda görülür. Temellerimizde gerçekten çok benziyoruz. Evrimi kabul edin ve Darwin'i kabul edin ve DNA'yı kabul edin. Hepsi burada kalmak için.

3 milyar yıl önce bakterilerin varlığı, o dönemde işlevsel bir genetik kodun varlığını gösterebilir. Bakteriyel, amfibi ve memeli protein sentezleme sistemleri tarafından tanınan kodon baz dizilerindeki dikkate değer benzerlik, bu gezegendeki tüm yaşam formlarının olmasa da çoğunun hemen hemen aynı genetik dili kullandığını ve dilin, muhtemelen birkaçıyla birlikte kullanıldığını göstermektedir. en az 500 Milyar yıl boyunca büyük değişiklikler.


Videoyu izle: 9. Sınıf Biyoloji - Proteinler. 2022 (Mayıs Ayı 2022).