Bilgi

Çoklu çoğaltma çatalları 'çarpışmadan' nasıl çalışır ve bu yöntemin faydası nedir?

Çoklu çoğaltma çatalları 'çarpışmadan' nasıl çalışır ve bu yöntemin faydası nedir?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Şu anda DNA replikasyonu hakkında biraz okuyorum ve şu ifadeye rastladım;

Çoğaltma sabit bir noktadan başlar ve çift yönlüdür... Ökaryotlarda, her biri çift yönlü ilerleyen çoklu çoğaltma çatalları vardır.

Ökaryotik bir hücrede tek, uzun bir DNA dizisi varsa, bununla ilgili olası sorunlar görüyorum:

Bu çatallar, çift iplikli DNA'nın bir bölümünün açılmasını ve her bir ipliğin yeni sentezlenmiş bir DNA parçasında çift iplik haline gelmesini içerir. Bir noktada, herhangi bir tek çatal iki yeni çift sarmallı molekül haline gelmeden önce, başka bir çatal bununla 'çarpışabilir' ve bunun bitmemiş bölümü kopyalamaya çalışmasına neden olabilir.

Basitçe, bir çoğaltma çatalı, çoğaltılan dizilerin sayısını katlanarak artırmadan diğeriyle nasıl buluşabilir?

Ayrıca, daha genel bir düzeyde, tipik olarak, çift sarmallı molekülün yalnızca tek bir kopyasının yapılması gerektiğinde, bunun gerçek faydasını bilmek oldukça ilgimi çeker.


Katlanarak artan dizi sayısına ulaşmak için, çoğaltmanın orijinal dizide değil, halihazırda kopyalanmış dizide başlatılması gerekir. Ökaryotlarda replikasyon sıkı bir şekilde kontrol edilir ve böyle bir olay düzenleme ile engellenir.

Hücre, şu anda sentezlenen ipliğin yeniden replikasyonunu nasıl önleyebilir? Çoğaltma adımlarını kesin bir sırayla zamanlayarak ve bu sıranın dışında herhangi bir çoğaltmayı önleyerek.

Çoğaltma, tanımlanan çoğaltma kaynaklarında başlar. G1 aşamasında, replikasyon öncesi kompleksler (pre-RC'ler) replikasyonların orijinlerinde birleştirilir. Bu ön RC'lerde replikasyon başlatılabilir, ancak ön RC'lerin kendisi hücre döngüsünün sonraki aşamalarında birleştirilemez. Çoğaltma başladığında, ön RC, artık çoğaltmayı başlatamayan ve yeniden çoğaltmayı önleyen bir RC sonrasına dönüştürülür.

Birden çok çoğaltma kaynağının yararı, çoğaltma hızıdır. Ökaryotik genomlar, basit bakterilerinkinden çok, çok daha büyük olabilir. Bunları tek bir çoğaltma kaynağı kullanarak çoğaltmak çok uzun zaman alacaktır.

Bazı ek okuma materyalleri:


Bakış Açısı: Hücre boyutu bir spandrel midir?

Tüm organizmalar hücrelerinin boyutunu kontrol eder. Burada bakterilerde büyüklük regülasyonu sorusuna odaklanıyoruz ve hücre boyutunu yöneten nicel yasaların ve büyüme hızına bağımlılığının, çoklu DNA replikasyon çatallarını desteklemek için gelişen bir düzenleyici mekanizmanın yan ürünleri olarak ortaya çıkabileceğini öne sürüyoruz. Özellikle, Lenski'nin uzun vadeli evrim deneyleri sırasında bakteri hücre boyutundaki artışın bu önerinin doğal bir sonucu olduğunu gösteriyoruz. Bu, evrim bağlamında hücre boyutunun bir 'pandrel' olabileceğini düşündürmektedir.


MALZEMELER VE YÖNTEMLER

Bakteriyel suşlar ve büyüme koşulları

Kullanılan tüm suşlar E. koli K-12 ve Tablo 1'de listelenmiştir. Hücreler, LB ortamında (LB) (10 g Tripton, 5 g NaCl, 250 ul 4 M NaOH/l) belirtilen sıcaklıkta (37°C veya 42°C) büyütüldü, 10 µg/ml tiamin ve %0,2 glikoz ve %0,5 kasamino asitler (glikoz-CAA ortamı) veya %0,2 glikoz (glikoz ortamı) ile desteklenmiş AB minimal ortamı ( 44). IBP05 suşu, kloramfenikol geninin 5΄GCGCTAAGAACCATCATTGGCTGTTAAAACATTATTAAAAATGTCAATGGCATATGAATATCCTCCTTAG ve 5΄CGATTTTTAGCAGACTGATATTTTCACTAATGACTTATTTTCTGCTTACCCTGGAGCTGCTTCGAAGTTCC içeren bölgelere yakın primerler ile amplifiye edilmesiyle yapılmıştır. oriC ve (45)'de açıklandığı gibi bu parçanın kromozoma eklenmesi. Bu iş için oluşturulan diğer tüm suşlar, Tablo 1'de belirtildiği gibi P1 transdüksiyonu (46) ile yapılmıştır. recBC Ts mutasyonları, UV ışınlarına duyarlılıklarıyla doğrulandı, ancak seqA2 ve seqA4 mutantlar, direnç işaretleyici genin ve mutasyonun oldukça düşük bir birlikte transdüksiyonu nedeniyle dizileme ile doğrulandı. NS oriCm3 mutantlar, akış sitometrisi ile belirlendiği gibi asenkron fenotipleriyle doğrulandı.

Suşlar

Gerginlik . İlgili özellikler. Kaynak .
MG1655 Vahşi tip ( 80, 81)
AB1157 Vahşi tip ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3kam Bu iş
UF340 seqA2( 20)
UF301 seqA4 barajı13( 20)
CAG18433 asnB3057::Tn10( 83)
SF169 UF301 asnB3057::Tn10UF301 x P1 CAG18433
N1331 Vahşi tip ( 84)
N1332 recA Ts ( 80, 81, 84)
NL40 DS941farkΔ6::KmR ( 85)
DS984 DS941xerC::mini-Mu CmR ( 86)
DS9008 DS941xerD::mini-Tn10(-9) ( 87)
SS1211 Δrep::kam ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (bu çalışma)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (bu çalışma)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (bu çalışma)
SK129 recB270 (Ts) recC271 (Ts) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (bu çalışma)
IBP01 SK129 seqA2SK129 x P1 UF340 (bu çalışma)
IBP03 SK129 seqA4SK129 x P1 SF169 (bu çalışma)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (bu çalışma)
IBP02 N1332 seqA2N1332 x P1 UF340 (bu çalışma)
IBP06 N1332 seqA4N1332 x P1 SF169 (bu çalışma)
IBP24 N1332 Δrep::kam N1332 x P1 SS1211 (bu çalışma)
IBP39 MG1655 Δrep::kam MG1655 x P1 SS1211 (bu çalışma)
IBP40 MG1655 seqA2 Δrep::kam IBP37 x P1 SS1211 (bu çalışma)
IBP41 MG1655 seqA4 Δrep::kam IBP38 x P1 SS1211 (bu çalışma)
IBP98 MG1655 oriCm3 Δrep::kam MG1655oriCm3 x P1 SS1211 (bu çalışma)
IF01 recA938::kam ( 88)
IBP87 MG1655 recA938::kam MG1655 x P1 IF01 (bu çalışma)
IBP80 MG1655 seqA2 recA938::kam IBP37 x P1 IF01 (bu çalışma)
IBP81 MG1655 seqA4 recA938::kam IBP38 x P1 IF01 (bu çalışma)
IBP100 MG1655 oriCm3 recA938::kam MG1655oriCm3 x P1 IF01 (bu çalışma)
IBP88 MG1655 farkΔ6::KmR MG1655 x P1 NL40 (bu çalışma)
IBP85 MG1655 seqA2 farkıΔ6::KmR IBP37 x P1 NL40 (bu çalışma)
IBP82 MG1655 seqA4 farkıΔ6::KmR IBP38 x P1 NL40 (bu çalışma)
IBP101 MG1655 oriCm3 farkıΔ6::KmR MG1655oriCm3 x P1 NL40 (bu çalışma)
IBP89 MG1655 xerC::mini-Mu CmR MG1655 x P1 DS984 (bu çalışma)
IBP74 MG1655 seqA2 xerC::mini-Mu CmR IBP37 x P1 DS984 (bu çalışma)
IBP83 MG1655 seqA4 xerC::mini-Mu CmR IBP38 x P1 DS984 (bu çalışma)
IBP90 MG1655 xerD::mini-Tn10(-9) MG1655 x P1 DS9008 (bu çalışma)
IBP68 MG1655 seqA2 xerD::mini-Tn10(-9) IBP37 x P1DS9008 (bu çalışma)
IBP84 MG1655 seqA4 xerD::mini-Tn10(-9) IBP38 x P1 DS9008 (bu çalışma)
SMR14323 MG1655 ΔaraBAD567 Δattλ::PBAD zfd2509.2::PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ::PN25tetR FRT ΔattλTn7::FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
Gerginlik . İlgili özellikler. Kaynak .
MG1655 Vahşi tip ( 80, 81)
AB1157 Vahşi tip ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3kam Bu iş
UF340 seqA2( 20)
UF301 seqA4 barajı13( 20)
CAG18433 asnB3057::Tn10( 83)
SF169 UF301 asnB3057::Tn10UF301 x P1 CAG18433
N1331 Vahşi tip ( 84)
N1332 recA Ts ( 80, 81, 84)
NL40 DS941farkΔ6::KmR ( 85)
DS984 DS941xerC::mini-Mu CmR ( 86)
DS9008 DS941xerD::mini-Tn10(-9) ( 87)
SS1211 Δrep::kam ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (bu çalışma)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (bu çalışma)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (bu çalışma)
SK129 recB270 (Ts) recC271 (Ts) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (bu çalışma)
IBP01 SK129 seqA2SK129 x P1 UF340 (bu çalışma)
IBP03 SK129 seqA4SK129 x P1 SF169 (bu çalışma)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (bu çalışma)
IBP02 N1332 seqA2N1332 x P1 UF340 (bu çalışma)
IBP06 N1332 seqA4N1332 x P1 SF169 (bu çalışma)
IBP24 N1332 Δrep::kam N1332 x P1 SS1211 (bu çalışma)
IBP39 MG1655 Δrep::kam MG1655 x P1 SS1211 (bu çalışma)
IBP40 MG1655 seqA2 Δrep::kam IBP37 x P1 SS1211 (bu çalışma)
IBP41 MG1655 seqA4 Δrep::kam IBP38 x P1 SS1211 (bu çalışma)
IBP98 MG1655 oriCm3 Δrep::kam MG1655oriCm3 x P1 SS1211 (bu çalışma)
IF01 recA938::kam ( 88)
IBP87 MG1655 recA938::kam MG1655 x P1 IF01 (bu çalışma)
IBP80 MG1655 seqA2 recA938::kam IBP37 x P1 IF01 (bu çalışma)
IBP81 MG1655 seqA4 recA938::kam IBP38 x P1 IF01 (bu çalışma)
IBP100 MG1655 oriCm3 recA938::kam MG1655oriCm3 x P1 IF01 (bu çalışma)
IBP88 MG1655 farkΔ6::KmR MG1655 x P1 NL40 (bu çalışma)
IBP85 MG1655 seqA2 farkıΔ6::KmR IBP37 x P1 NL40 (bu çalışma)
IBP82 MG1655 seqA4 farkıΔ6::KmR IBP38 x P1 NL40 (bu çalışma)
IBP101 MG1655 oriCm3 farkıΔ6::KmR MG1655oriCm3 x P1 NL40 (bu çalışma)
IBP89 MG1655 xerC::mini-Mu CmR MG1655 x P1 DS984 (bu çalışma)
IBP74 MG1655 seqA2 xerC::mini-Mu CmR IBP37 x P1 DS984 (bu çalışma)
IBP83 MG1655 seqA4 xerC::mini-Mu CmR IBP38 x P1 DS984 (bu çalışma)
IBP90 MG1655 xerD::mini-Tn10(-9) MG1655 x P1 DS9008 (bu çalışma)
IBP68 MG1655 seqA2 xerD::mini-Tn10(-9) IBP37 x P1DS9008 (bu çalışma)
IBP84 MG1655 seqA4 xerD::mini-Tn10(-9) IBP38 x P1 DS9008 (bu çalışma)
SMR14323 MG1655 ΔaraBAD567 Δattλ::PBAD zfd2509.2::PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ::PN25tetR FRT ΔattλTn7::FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
Gerginlik . İlgili özellikler. Kaynak .
MG1655 Vahşi tip ( 80, 81)
AB1157 Vahşi tip ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3kam Bu iş
UF340 seqA2( 20)
UF301 seqA4 barajı13( 20)
CAG18433 asnB3057::Tn10( 83)
SF169 UF301 asnB3057::Tn10UF301 x P1 CAG18433
N1331 Vahşi tip ( 84)
N1332 recA Ts ( 80, 81, 84)
NL40 DS941farkΔ6::KmR ( 85)
DS984 DS941xerC::mini-Mu CmR ( 86)
DS9008 DS941xerD::mini-Tn10(-9) ( 87)
SS1211 Δrep::kam ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (bu çalışma)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (bu çalışma)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (bu çalışma)
SK129 recB270 (Ts) recC271 (Ts) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (bu çalışma)
IBP01 SK129 seqA2SK129 x P1 UF340 (bu çalışma)
IBP03 SK129 seqA4SK129 x P1 SF169 (bu çalışma)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (bu çalışma)
IBP02 N1332 seqA2N1332 x P1 UF340 (bu çalışma)
IBP06 N1332 seqA4N1332 x P1 SF169 (bu çalışma)
IBP24 N1332 Δrep::kam N1332 x P1 SS1211 (bu çalışma)
IBP39 MG1655 Δrep::kam MG1655 x P1 SS1211 (bu çalışma)
IBP40 MG1655 seqA2 Δrep::kam IBP37 x P1 SS1211 (bu çalışma)
IBP41 MG1655 seqA4 Δrep::kam IBP38 x P1 SS1211 (bu çalışma)
IBP98 MG1655 oriCm3 Δrep::kam MG1655oriCm3 x P1 SS1211 (bu çalışma)
IF01 recA938::kam ( 88)
IBP87 MG1655 recA938::kam MG1655 x P1 IF01 (bu çalışma)
IBP80 MG1655 seqA2 recA938::kam IBP37 x P1 IF01 (bu çalışma)
IBP81 MG1655 seqA4 recA938::kam IBP38 x P1 IF01 (bu çalışma)
IBP100 MG1655 oriCm3 recA938::kam MG1655oriCm3 x P1 IF01 (bu çalışma)
IBP88 MG1655 farkΔ6::KmR MG1655 x P1 NL40 (bu çalışma)
IBP85 MG1655 seqA2 farkıΔ6::KmR IBP37 x P1 NL40 (bu çalışma)
IBP82 MG1655 seqA4 farkıΔ6::KmR IBP38 x P1 NL40 (bu çalışma)
IBP101 MG1655 oriCm3 farkıΔ6::KmR MG1655oriCm3 x P1 NL40 (bu çalışma)
IBP89 MG1655 xerC::mini-Mu CmR MG1655 x P1 DS984 (bu çalışma)
IBP74 MG1655 seqA2 xerC::mini-Mu CmR IBP37 x P1 DS984 (bu çalışma)
IBP83 MG1655 seqA4 xerC::mini-Mu CmR IBP38 x P1 DS984 (bu çalışma)
IBP90 MG1655 xerD::mini-Tn10(-9) MG1655 x P1 DS9008 (bu çalışma)
IBP68 MG1655 seqA2 xerD::mini-Tn10(-9) IBP37 x P1DS9008 (bu çalışma)
IBP84 MG1655 seqA4 xerD::mini-Tn10(-9) IBP38 x P1 DS9008 (bu çalışma)
SMR14323 MG1655 ΔaraBAD567 Δattλ::PBAD zfd2509.2::PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ::PN25tetR FRT ΔattλTn7::FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
Gerginlik . İlgili özellikler. Kaynak .
MG1655 Vahşi tip ( 80, 81)
AB1157 Vahşi tip ( 82)
MG1655oriCm3oriCm3( 43)
IBP05 oriCm3kam Bu iş
UF340 seqA2( 20)
UF301 seqA4 barajı13( 20)
CAG18433 asnB3057::Tn10( 83)
SF169 UF301 asnB3057::Tn10UF301 x P1 CAG18433
N1331 Vahşi tip ( 84)
N1332 recA Ts ( 80, 81, 84)
NL40 DS941farkΔ6::KmR ( 85)
DS984 DS941xerC::mini-Mu CmR ( 86)
DS9008 DS941xerD::mini-Tn10(-9) ( 87)
SS1211 Δrep::kam ( 63)
IBP36 MG1655 oriCm3MG1655 x P1 IBP05 (bu çalışma)
IBP37 MG1655 seqA2MG1655 x P1 UF340 (bu çalışma)
IBP38 MG1655 seqA4MG1655 x P1 SF169 (bu çalışma)
SK129 recB270 (Ts) recC271 (Ts) ( 53)
IBP04 SK129 oriCm3SK129 x P1 IBP05 (bu çalışma)
IBP01 SK129 seqA2SK129 x P1 UF340 (bu çalışma)
IBP03 SK129 seqA4SK129 x P1 SF169 (bu çalışma)
ER89 SK129 ΔseqA21( 39)
IBP07 N1332 oriCm3N1332 x P1 IBP05 (bu çalışma)
IBP02 N1332 seqA2N1332 x P1 UF340 (bu çalışma)
IBP06 N1332 seqA4N1332 x P1 SF169 (bu çalışma)
IBP24 N1332 Δrep::kam N1332 x P1 SS1211 (bu çalışma)
IBP39 MG1655 Δrep::kam MG1655 x P1 SS1211 (bu çalışma)
IBP40 MG1655 seqA2 Δrep::kam IBP37 x P1 SS1211 (bu çalışma)
IBP41 MG1655 seqA4 Δrep::kam IBP38 x P1 SS1211 (bu çalışma)
IBP98 MG1655 oriCm3 Δrep::kam MG1655oriCm3 x P1 SS1211 (bu çalışma)
IF01 recA938::kam ( 88)
IBP87 MG1655 recA938::kam MG1655 x P1 IF01 (bu çalışma)
IBP80 MG1655 seqA2 recA938::kam IBP37 x P1 IF01 (bu çalışma)
IBP81 MG1655 seqA4 recA938::kam IBP38 x P1 IF01 (bu çalışma)
IBP100 MG1655 oriCm3 recA938::kam MG1655oriCm3 x P1 IF01 (bu çalışma)
IBP88 MG1655 farkΔ6::KmR MG1655 x P1 NL40 (bu çalışma)
IBP85 MG1655 seqA2 farkıΔ6::KmR IBP37 x P1 NL40 (bu çalışma)
IBP82 MG1655 seqA4 farkıΔ6::KmR IBP38 x P1 NL40 (bu çalışma)
IBP101 MG1655 oriCm3 farkıΔ6::KmR MG1655oriCm3 x P1 NL40 (bu çalışma)
IBP89 MG1655 xerC::mini-Mu CmR MG1655 x P1 DS984 (bu çalışma)
IBP74 MG1655 seqA2 xerC::mini-Mu CmR IBP37 x P1 DS984 (bu çalışma)
IBP83 MG1655 seqA4 xerC::mini-Mu CmR IBP38 x P1 DS984 (bu çalışma)
IBP90 MG1655 xerD::mini-Tn10(-9) MG1655 x P1 DS9008 (bu çalışma)
IBP68 MG1655 seqA2 xerD::mini-Tn10(-9) IBP37 x P1DS9008 (bu çalışma)
IBP84 MG1655 seqA4 xerD::mini-Tn10(-9) IBP38 x P1 DS9008 (bu çalışma)
SMR14323 MG1655 ΔaraBAD567 Δattλ::PBAD zfd2509.2::PN25tetR FRTKanFRT( 70)
SMR13957 MG1655 Δattλ::PN25tetR FRT ΔattλTn7::FRTcatFRT PN25tetO gam-GFP( 70)
EH137 MG1655 PN25tetR PN25tetO gam-GFPMG1655 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH138 MG1655 seqA2 PN25tetR PN25tetO gam-gfpIBP37 x P1 SMR14323 x P1 SMR13957 (bu çalışma)
EH139 MG1655 seqA4 PN25tetR PN25tetO gam-gfpIBP38 x P1 SMR14323 x P1 SMR13957 (bu çalışma)

Darbeli alan jel elektroforezi için agaroz tıkaçlarda DNA hazırlanması

Gece kültürleri recBC (Ts) suşları 22°C'de (izin verilen sıcaklık) bir optik yoğunluğa (OD) seyreltilmiştir.600) 0.005 ve 42°C'de (izin vermeyen sıcaklık) LB ortamında OD'ye büyütüldü600 0.15 (üssel faz). Yaklaşık 2.5 x 108 hücreye (Coulter Counter Multisizer, Beckman) karşılık gelen bir kültür hacmi santrifüjlendi ve iki kez Tris/NaCl (10 mM Tris–HCl, pH 7.6, 1 M NaCl) (başlangıçta 1 mi) içinde yeniden süspanse edildi. Eşit miktarlarda hücre süspansiyonu (Tris/NaCl içinde yeniden süspanse edildi) ve erimiş temiz kesilmiş agaroz (Bio-Rad) 42°C'ye getirildi ve birleştirildi. Toplam 90 µl agaroz/hücre süspansiyonu tek kullanımlık kalıpların (Bio-Rad) kuyularına dağıtıldı, katılaştırıldı, 2.5 ml EC lizis tamponu (6 mM Tris–HCl, pH 7.6, 1 M) içeren 50 ml'lik bir tüpe atıldı. NaCl, 100 mM EDTA, NaOH ile pH 7.6'ya ayarlanmış, %1 n-lauril sarkozin, 1 mg/ml lizozim ve 20 ug/ml RNaz A) ve gece boyunca 37°C'de inkübe edildi. EC lizis tamponunun çıkarılmasından sonra, tıkaçlar TE tamponu (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) ile durulandı ve 2.5 ml ESP tamponu eklendi (500 mM EDTA (pH 9-9.5'e ayarlandı) NaOH ile), %1 n-lauril sarkozin, proteinaz K (50 ug/ml)), ardından 37°C'de gece boyunca (veya 48-72 saat) inkübasyon. Daha sonra tıkaçlar, her biri 30 ml TE tamponu kullanılarak 2 saatlik üç yıkama ile 25°C'de TE tamponu ile yıkandı. Yukarıdaki adımlar, bakteri DNA'sının darbeli alan jel elektroforezi (PFGE) için tıkaçların hazırlanmasına yönelik standart bir protokolden alınmıştır ( 47).

CHEF-DR III PFGE ve miktar tayini

DNA'yı çözmek için bir CHEF-DR III Darbeli Alan Elektroforez sistemi (Bio-Rad) kullanıldı. Çalışma süresi 21 saate ayarlandı sıcaklık 14°C ilk ve son geçiş süreleri sırasıyla 60 ve 120 s idi, volt/cm 6'ya ayarlandı dahil edilen açı 120 idi ve çalışma tamponu olarak 0,5 x TBE kullanıldı. Jel daha sonra SYBR Altın Nükleik Asit Jel Lekesi (Life Technologies) ile boyandı ve arka plan çıkarma için yuvarlanan disk yöntemiyle Genetool (Syngene) yazılımı kullanılarak nicelendirildi. SYBR Altın Nükleik Asit Jel Lekesi (Life Technologies), floresan yoğunluğu ile DNA içeriği arasında daha önce de uygulandığı gibi en az iki büyüklük sırası ( 48) arasında doğrusal bir ilişki verir ( 49). Kromozomal parçalanma yüzdesi, önce kuyuda ve kuyunun hemen altında bulunan DNA'nın (sırasıyla parçalanmamış DNA ve büyük olasılıkla tek bir çentikli kromozomlar) ölçülmesi ve ardından şeridin geri kalanındaki DNA'nın ölçülmesiyle bulundu. Parçalanmış DNA değeri daha sonra toplam DNA değerine bölündü. Bir kromozomal parçalanmanın miktar tayini rep recBC Bu yöntemle mutant, daha önce yayınlanmış sonuçlarla (~%50) uyum içindeydi (14).

Akış sitometrisi ve DNA histogramlarının yorumlanması

Dengeli büyümeyi sağlamak için hücreler birkaç nesil boyunca katlanarak büyütüldü. 0.15'lik bir OD'de, üstel olarak büyüyen hücreler ya doğrudan hasat edildi ya da hasattan önce üç ila dört nesil eşdeğer süre boyunca rifampisin (300 ug/ml) ve sefaleksin (10 ug/ml) ile işlendi. Hem doğrudan hasat edilen hem de muamele edilen hücreler, TE tamponunda (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0) yeniden süspanse edildi ve %70 etanol içinde sabitlendi. Protein boyama (kütleyi temsil eden) için floresein izotiyosiyanat (FITC, Sigma-Aldrich) ( 50) ve DNA boyama için Hoechst 33258 (Sigma-Aldrich) ( 51) kullanıldı. Akış sitometrisi, 488 nm argon iyon lazeri ve 355 nm kripton lazeri (BD Biosciences) ile donatılmış bir LSR-II akış sitometresi ile yapıldı ve sonuçlar FlowJo yazılımı (Tree Star, Inc.) kullanılarak analiz edildi.

Rifampisin ve sefaleksin, sırasıyla replikasyonun başlamasını ve hücre bölünmesini inhibe eder. Hücreler, bu ilaçlar eklendikten sonra yeni bir replikasyon turu başlatamazlar, ancak devam eden replikasyon turlarını (bölmeden) tamamlayabilirler. Tedavi edilen hücrelerin DNA histogramları, böylece hücre başına 2 değerleri olan bir tamsayı kromozomu verir. n veya 2 n+1, nerede n = 0, 1, 2, 3… başlatmanın gerçekleştiği nesli temsil eder. Bununla birlikte, bu model yalnızca eş zamanlı replikasyon başlangıcına (tüm kökenler aynı anda ateşlenir) ve replikasyon uzamasının başarılı bir şekilde tamamlanmasına (başlatılan tüm çatallar uca ulaşan) sahip hücreler için geçerlidir. Asenkron başlangıçlar sergileyen hücrelerin DNA histogramları ayrıca düzensiz sayıda kromozom (örneğin 3, 5, 7, vb.) içerecektir ve replikasyon uzaması ile ilgili problemler, 'tükenme' DNA'sında belirgin tepe noktalarının olmaması olarak görülecektir. histogramlar (yani rifampisin ve sefaleksin ile tedavi edilen hücrelerin histogramları).

RecA işlevinin yokluğunda replikasyon tükenmesi

30°C'de üssel olarak büyüyen (OD~0.15'e kadar) hücre kültürleri ayrıldı ve her kültüre rifampisin (450 ug/ml) ve sefaleksin (10 ug/ml) ilave edildi. RecA fonksiyonunun kaybı için bir kısım izin verilen sıcaklıkta (30°C) tutuldu, diğeri ise izin verilmeyen sıcaklığa (42°C) kaydırıldı. Hücreler, ilaç tedavisinden önce ve ilaçların varlığında 3-4 üretim zamanından sonra toplandı ve her sıcaklıkta replikasyon çatalı tükenmesini karşılaştırmak için akış sitometrisi ile analiz için sabitlendi. Akış histogramları, FlowJo (Tree Star, Inc.) yazılımı kullanılarak analiz edildi. Kromozom sayısındaki hücre başına ortalama azalma, önce her bir kromozom zirvesindeki hücre sayısı belirlenerek, bu değer toplam kromozom sayısını elde etmek için her bir kromozom sayısıyla çarpılarak ve ardından toplam kromozom sayısına bölünerek elde edildi. hücreler sayılır. Ortalama kromozom/hücre sayısının uygun bir tahmini için toplam 50.000 hücre sayıldı. Son olarak, izin verilen ve izin verilmeyen sıcaklıklarda toplam kromozom sayısı karşılaştırılmıştır.

Canlılık testleri

Gecelik kültürler, yaklaşık olarak aynı OD'ye kadar büyüme ortamı veya %1 NaCl ile seri olarak seyreltildi. 10 -2 ila 10 -6 arasında değişen toplam 5 ul seyreltme agar plakaları üzerine damlatıldı (agar tipi şekillerde belirtilmiştir).

Gam-GFP indüksiyonu, floresan mikroskopi görüntüleme ve GFP'nin akış sitometrisi

Hücreler, 10 ng/ml anhidrotetrasiklin eklenerek Gam-GFP indüklenmeden önce OD~0.15'e büyütüldü. Büyümeye 60 dakika devam edildi, bu sırada hücreler 17 x 28 mm'lik bir agaroz ped (10 ng/ml anhidrotetrasiklin ile %1 fosfat tamponlu salin (PBS) içeren) üzerinde immobilize edildi ve bir no. 1.5 lamel. Görüntüler, bir Leica EL6000 metal halide lamba ve bir Hamamatsu ImagEM 1k kamera ile donatılmış bir Leica DM6000 mikroskobu ile elde edildi. Faz kontrastlı görüntüleme, bir HCX PL APO 100 x /1.40 NA objektifi ile yapıldı. Floresan görüntüleme, dar bant geçişli (BP) filtre setleri (GFP için BP 470/40'ta uyarma ve BP 525/50'de emisyon) kullanılarak yapıldı.

Floresan mikroskopi deneylerinde, vahşi tipte GFP-görüntülemesi için tam olarak aynı ayarların kullanılmasına özen gösterildi ve seqA Yanlış yorumlamayı önlemek için mutant hücreler (örn. aynı yoğunluk, maruz kalma süresi). Kamuya açık ImageJ yazılımını kullanarak, işlem sonrası sadece parlaklık/kontrast ayarladık ve bunu, seqA mutantlar ve vahşi tip hücreler.

Gam-GFP'nin akış sitometrisi Accuri C6 (BD Biosciences) ile yapıldı ve sonuçlar FlowJo yazılımı (Tree Star, Inc.) kullanılarak analiz edildi. Hücreler, 60 dakikalık Gam-GFP (10 ng/ml anhidrotetrasiklin) indüksiyonu ile glukoz-CAA ortamında yukarıda tarif edildiği gibi büyütüldü, hasat edildi ve akış sitometrisi ile analizden önce doğrudan PBS içinde yıkandı. Numune başına toplam 50.000 hücre kaydedildi.

Nükleoidlerin floresan mikroskopisi

Sabit hücrelerin nükleoidleri Hoechst 33258 ile boyandı ve (52)'de tarif edildiği gibi floresan mikroskobu ile görselleştirildi.


Bchem218 SON

i) İlgili bakteri kromozomundan DNA fragmanlarını AmpR'yi kodlayan bakterilere dönüştürmek, ii) bu bakterileri ampisilin ortamına yerleştirmek, iii) herhangi bir
Ampisilin ortamında büyüyen dönüştürülmüş bakteriler, artık kolaylıkla tanımlanabilen, ilgilenilen bakteri kromozomundan fonksiyonel bir köken içermelidir.
sıralayarak.

i) Bakteri kromozomunu AmpR içermeyen bir bakteriye dönüştürün, ii) ampisilin ortamına plaka dönüştürücüler, iii) üzerinde büyüyen herhangi bir dönüştürülmüş bakteri
ampisilin ortamı, artık dizileme ile kolaylıkla tanımlanabilen, ilgilenilen bakterilerden fonksiyonel bir köken içermelidir.

i) AmpR gibi seçilebilir bir işaretleyici içeren bir plazmitten orijini çıkarın, ii) bakterinin sindirimi ile üretilen DNA fragmanlarında ligat yapın.
ilgilenilen kromozom, iii) elde edilen rekombinantları AmpR'den yoksun bakteri hücrelerine dönüştürmek ve ampisilin ortamı üzerine plaka, iv) herhangi bir dönüştürülmüş bakteri
ampisilin ortamında büyüyen, artık dizileme ile kolaylıkla tanımlanabilen, ilgilenilen bakteri kromozomundan fonksiyonel bir köken içermelidir.

i) AmpR gibi seçilebilir bir işaretleyici içeren bir plazmidi sindirin, ii) AmpR kodlayan DNA fragmanlarını ilgilenilen bakteri kromozomuna bağlayın, iii)
elde edilen rekombinantları AmpR'den yoksun bakterilere ve plakayı ampisilin ortamına dönüştürmek, iv) ampisilin ortamında büyüyen herhangi bir dönüştürülmüş bakteri
artık dizileme ile kolayca tanımlanabilen, ilgilenilen bakterilerden fonksiyonel bir köken içerir.


Teşekkür

Substrat hazırlığı ile ilgili bilgileri paylaştığı için A. Mazin'e minnettarız. Sırasıyla saflaştırılmış WRN ve WRN-E84A proteinlerinin alikotlarını sağladıkları için P. Janscak'a (Zürih Üniversitesi) ve D. Orren'e (Kentucky Üniversitesi Tıp Fakültesi) teşekkür ederiz. PARP1 fragmanının üretimi için yapıları sağladığı için G. de Murcia'ya (Ecole Supérieure de Biotechnologie de Strasbourg) teşekkür ederiz. Eleştirel tartışmalar için Y. Ayala'ya ve rekombinant protein üretimindeki yardımları için G. Triolo'ya teşekkür ederiz. Louis'deki Washington Üniversitesi Mühendislik ve Uygulamalı Bilimler Okulu'nun Nano Araştırma Tesisi'ne teşekkür ederiz. ECS-0335765, mikrofabrikasyon ve temiz oda tesisi kullanımı için. EM ile ilgili teknik yardım için Zürih Üniversitesi Mikroskopi ve Görüntü Analizi Merkezine de teşekkür ederiz. Bu çalışma, Saint Louis Üniversitesi Tıp Fakültesi'ndeki Doisy Biyokimya ve Moleküler Biyoloji Bölümü'nden ve Saint Louis Üniversitesi Kanser Merkezi'nden başlangıç ​​finansmanı ve Saint Louis Üniversitesi Başkanlık Araştırma Fonu ve Associazione Italiana per la Ricerca sul'den bağışlarla desteklenmiştir. Cancro'dan (AIRC10510) AV'ye ABD Ulusal Sağlık Enstitüleri, R.J.M.'ye CA77852 verir. Jr. İsviçre Ulusal Bilim Vakfı, M.L.'ye PP0033-114922 ve PP00P3-135292 verir. ve Zürcher Universitätsverein'den (ZUNIV) Fonds zur Förderung des Akademischen Nachwuchses'in (FAN) M.L. ve A.R.C.


Tartışma

DNA replikasyonu ve onarımı, genomun doğru bir şekilde kopyalanmasını sağlayan iki temel biyolojik süreçtir. Daha önce mtp53 ve DNA replikasyon proteinlerinin bir birlikteliğini göstermiştik (8). Burada mtp53 ve PARP1'in TNBC hücrelerinde DNA'yı kopyalama ile ilişkili olduğunu gösterdik. Ayrıca, mtp53, TNBC'de yeni oluşan DNA ile PARP1 ilişkisini arttırdı ve hücre proliferasyonunu arttırdı. Meme kanserli hastaların tüm alt tipleri için TCGA ve TMA analizinden alınan kanser örneklerinin analizinde artan p53 ekspresyonu ve PARP1 arasında pozitif bir ilişki gözlemledik, bu da mtp53 ve PARP ekspresyonunun prognostik bir belirteç olarak puanlanmasının potansiyel TNBC'ler için bir vekil olarak hareket edebileceğini düşündürür. kombinasyon talazoparib-temozolomid tedavisinden fayda görecektir. Bulgularımız, mtp53'ün (yeşil renkle gösterilmiştir) replikasyon DNA ile birleştiği ve MCM proteinlerini (mor ile gösterilmiştir) ve PARP1'i (kırmızı ile gösterilmiştir) stresli replikasyon DNA üzerinde topladığı ve replikasyonun ilerlemesine izin verdiği bir model önermemizi (bakınız Şekil 5A) teşvik etmektedir. DNA hasarı varlığında bile, böylece tümör oluşumunu teşvik eder. Talazoparib yakın zamanda BRCA mutasyonlu metastatik meme kanserleri için FDA onayı almıştır (43). Daha önce mtp53 R273H'nin talazoparib'in PARP1'i kromatin üzerinde yakalama yeteneğini arttırdığını göstermiştik (7, 8). TNBC'de mtp53 R273H ifadesinin, PARPi ajanı talazoparib'in temozolomid ile kombinasyon halinde artan PARP yakalaması nedeniyle hücre ölümünü indüklemesine izin verdiğini öneriyoruz (sarı renkle gösterilmiştir, bkz. Şekil 5B).

Mutant R273H p53, PARP1 ve MCM2-7 için model, hücre ölümüne karşı tümörijenezi teşvik eden DNA'nın replikasyonu üzerinde. DNA replikasyonu üzerinde mtp53 R273H, PARP ve MCM2-7'nin koordinasyonu, tümörijenezde bir rol anlamına gelir. A, MCM2-7 (mor), mtp53 R273H (yeşil) ve PARP (kırmızı), hasar meydana geldiğinde replikasyon DNA (i) ile etkileşime girer, anormal onarımı kolaylaştırmaya yardımcı olur (ii), hücrelerin hayatta kalmasına izin vererek, tümör oluşumunu teşvik eder (iii). B, Yüksek PARP ve mtp53 eksprese eden hücreler (i), temozolomid ile kombinasyon halinde talazoparib (sarı) ile tedavi edildiğinde, PARP replike kromatin üzerinde tutulur, bu da onarılmamış DNA hasarını (tuğla ii) artırarak hücre ölümünü teşvik eder (iii).

DNA replikasyonu, menşe ruhsatlandırma ve ateşlemeyi (lisans verme ve başlatıcı faktörler), gevşemeyi (helikazlar) ve gevşemeyi (topoizomerazlar) düzenleyen çeşitli protein kompleksleri tarafından düzenlenir. GOF mtp53, DNA replikasyon orijin ateşlemesini arttırır (9) ve mutant p53, Cdc7'yi (11) transaktive eder. Ek olarak, mtp53 R273H'nin, TopBP1'in normal koşullar altında Cdk2 tarafından indüklenen Treslin ile etkileşimini kolaylaştırdığı gösterilmiştir (13). Daha önce mtp53'ün çoklu meme kanseri hücre dizilerinde ve benzer insan R175H knockin mutasyonuna sahip fare tümörlerinde MCM replikasyon lisanslama faktörleriyle doğrudan etkileşime girdiğini tanımlamıştık (Trp53 R172H/R172H ref. 8). MCM'lerin aşırı ekspresyonu, meme kanserli hastalarda daha kısa sağkalım ile güçlü bir şekilde ilişkilidir (44). Meme tümörü oluşumu sırasında Cdc7 ekspresyonunun yukarı regülasyonu, hücre döngüsü ilerlemesini hızlandırmak, tümör farklılaşmasını durdurmak, genomik instabiliteyi arttırmak ve hastalıksız sağkalımı azaltmakla bağlantılıdır (45). Cdc7 aracılı fosforilasyon, replikasyon kökenlerini ateşlemek için başlatma kompleksinin montajını tetikler (12). Bu nedenle, Cdc7 kinazın önceden oluşturulmuş replikasyon öncesi komplekslere düzenlenmesi, replikasyon zamanlaması kontrolü için ana belirleyicidir.

DNA lifi tahlili, aktive edilmiş onkogenlerin, sonlandırılmış çatalların ve çatal asimetrisinin fraksiyonunda bir artışa, bunun yanında replikasyon çatal hızında bir azalma ve artan orijin ateşlemesinin indüklediğini gösterdi (35). Onkogenler, intragenik olan ve çökmeye meyilli replikasyon çatallarına yol açan kurucu kökenlerin aksine, yeni replikasyon kökenlerinin ateşlenmesini indükler (46). İntragenik, onkogen kaynaklı kökenlerden başlayan çatalların çökmesi, kısaltılmış G'li hücrelerde artan replikasyon-transkripsiyon çatışmalarına bağlanabilir.1 (46) Dikkat çekici bir şekilde, Okazaki fragmanlarının (OK-Seq) genom çapında izolasyonu ve dizilenmesi, insan genom replikasyonunun kapsamlı manzarasını ortaya çıkardı (47). Replikasyon başlatma bölgeleri çoğunlukla transkripsiyona tabi değildir, açık kromatin bakımından zengindir ve replikasyon çatalı ilerlemesi ile önemli ölçüde transkripsiyon başlangıcı ile birlikte yönlendirilir (47). GOF mtp53'ün DNA'yı kopyalamadaki rolünü aydınlatmak için daha fazla çalışmaya ihtiyaç vardır.

PARP inhibitörleri, substratlara eklenen ADP-ribozun enzimatik aktivitesini bozar, bu da PARP'ın baz eksizyon onarımı, tek iplikli kopma onarımı ve DNA hasar algılamadaki işlevini baskılar (48). Birçok PARP inhibitörü ayrıca proteinin kromatin üzerinde tutulmasına neden olarak daha fazla DNA hasarına ve toksik DNA-PARP komplekslerinin oluşumu yoluyla hücrelerin öldürülmesine neden olur (49). PARP inhibitörleri, HR onarım genlerinde bialelik mutasyonları olan ailesel ve sporadik meme ve yumurtalık kanserlerinde kullanılır. BRCA1, BRCA2, veya PALB2 (49) Hızlı bölünen kanser hücrelerinde PARP1 fonksiyonunun inhibisyonu, esas olarak çift zincir kırıkları olan kırık replikasyon çatallarına yol açan tek zincirli kopmaların birikmesine neden olur (DSB ref. 50). Normalde HR tarafından onarılacak olan bu DSB'ler, BRCA1 eksikliği olan hücrelerde onarılmaz. Bu çalışmada, kromatin üzerinde mtp53 R273H ile ilişkili PARP1'in ve gelişmiş PARilasyonun da bu ilişkiyi arttırdığını gösterdik. Ayrıca, R273H mtp53 ifade eden meme kanseri PDX modelinde, wtp53 ifade eden bir PDX modelinden daha yüksek PARilasyon seviyeleri tespit edildi. PARP aktivitesi, PARilasyon seviyeleri ile ilişkili olduğundan, düşük PAR seviyelerinin tespiti, wtp53 taşıyan dokuda sınırlı bir PARP inhibitör toksisitesi ile PARP'ın içsel bir düşük aktivitesini gösterebilir. Şekil 4A, TNBC örneklerinde p53 ve PARP arasında pozitif bir korelasyon gösterir (kırmızı noktalara bakın). İlginç bir şekilde ER + meme kanseri örnekleri, incelenen hastaların tümü olmasa da bazıları için pozitif bir korelasyon gösterir (yeşil noktalara bakın). Yüksek p53 seviyeleri, stabilize mtp53 ile ilişkilidir ve bu, TNBC'de ER + meme kanserinden daha sık bulunur. Örneklerde PARP ve mtp53'ün stabilizasyonu için olası bir moleküler mekanizma, replikasyon stresi sırasında mtp53'ün stabilize edilmesinden kaynaklanabilir, bu da PARP aktivasyonuna ve dolayısıyla artan işe alıma neden olabilir. Replikasyon stresi, hem mtp53 hem de PARP'ın stabilizasyonu ile sonuçlanan yolların aktivasyonunun önemli bir kolaylaştırıcısı olabilir. Bununla birlikte, mtp53'ün PARP'ın transkripsiyonunu değiştirme olasılığı vardır. Verilerimiz, mtp53 R273H ve PARP arasındaki karşılıklı konuşmanın karmaşıklığını göstermektedir ve kanser hücrelerinde, artan PARP ve mtp53 seviyelerinin, replikasyon stresi varlığında hücre hayatta kalması için bir vekil olarak kullanılabileceğini düşündürmektedir. It will be interesting to determine whether talazoparib in combination with the DNA-damaging agent temozolomide suppresses organoid growth in 3D culture and possibly xenograft (and/or PDX) growth canlıda. Our results suggest that the detection of coexpression of mtp53 (which is mutated in more than 80% of TNBC) and high expression of PARP may be a good combined biomarker to precisely identify the cancer patient populations that will benefit from combined PARPi talazoparib with temozolomide treatment.


Sonuçlar

RecD2 Inhibits Resumption of Replication by Paused Replisomes.

Superfamily 1 helicases that translocate 3′-5′ along ssDNA (E. koli Rep and UvrD and Bacillus stearothermophilus PcrA) promote movement of E. koli replisomes through nucleoprotein complexes, whereas D. radyodurans RecD2 and bacteriophage T4 Dda, 5′-3′ superfamily 1 helicases do not (10). Indeed, addition of RecD2 results in an apparent increase in the degree of replication blockage at protein–DNA complexes in vitro (10). We investigated the basis for this apparent increase in fork blockage by RecD2. We used a system in which replisomes could be blocked completely by a large array of lak repressor–operator complexes and then the block relieved by subsequent addition of isopropyl β-D-1-thiogalactopyranoside (IPTG), allowing monitoring of the ability of blocked replisomes to resume replication (18)(Fig. 1A and Fig. S1). Replisomes were reconstituted on plasmid templates bearing oriC and 22 tandem lak operatörler. In the absence of a topoisomerase, replisomes could proceed only a limited distance along the template owing to accumulation of positive supercoiling. Continued fork movement depended on cleavage of the template by a restriction enzyme to relieve the topological strain (17) (Fig. 1A, ii ve iii and Fig. S1) with the site of cleavage allowing only one of the two forks to progress toward the lak operators (Fig. 1A, iii ve iv).

RecD2 inactivates replication forks blocked by nucleoprotein complexes in vitro. (A) reaction scheme to monitor the ability of replisomes halted at LacI–lacO complexes to continue replication upon IPTG-induced dissociation of the barrier. (B, i) Denaturing agarose gel of replication products formed with pPM561 in the absence or the presence of 400 nM LacI with or without subsequent addition of 1 mM IPTG. Helicases added to 100 nM final concentration at step iv/v (A) are indicated. Sizes of markers in kilobases are indicated. (B, ii) Levels of the 5.2-kb leading strand products formed in the presence of repressor after subsequent addition of IPTG relative to those obtained in the absence of repressor (see lane 1 in B). (C) The effects of wild-type and pinless RecD2 on the ability of forks paused at LacI–lacO complexes to continue upon addition of IPTG.

In the absence of lak repressor, replication generated a population of lagging strands of ∼0.5 kb and leading strands of 1.3 and 5.2 kb (Fig. 1A, vi ve B, lane 1). In the presence of repressor, 3.5-kb, rather than 5.2-kb, leading strands were generated (Fig. 1A, vi ve B, lane 2 and Fig. S1), as expected if movement of replisomes was inhibited within the repressor–operator array. Subsequent addition of IPTG to these blocked forks relieved this inhibition (Fig. 1B, lane 3), reflecting the initial retention of activity of replisomes blocked at lak repressor–operator complexes (18).

The impact of helicases on the ability of blocked replisomes to resume replication upon addition of IPTG was analyzed. Rep, UvrD, and PcrA did not promote replication through the 22 repressor–operator complexes in the absence of IPTG (Fig. 1B, lanes 5, 7, and 9). Addition of IPTG allowed resumption of replication even in the presence of these helicases, indicating that Rep, UvrD, and PcrA did not inhibit resumption of replication upon removal of a block (Fig. 1 B, ben, lanes 4, 6, and 8 and 1 B, ii). In contrast, RecD2 reduced severely the ability of replisomes to resume replication after IPTG addition (Fig. 1 B, ben, compare lanes 10 and 11 with lanes 3 and 2, and 1 B, ii). However, a mutant RecD2 protein, pinless RecD2, that retains DNA binding but not helicase activity (23) failed to inhibit resumption of replication (Fig. 1C). The helicase activity of RecD2 thus inhibits continued movement of paused replisomes upon dissociation of a blocking nucleoprotein complex. T4 Dda, another superfamily 1 5′-3′ helicase, also inhibited resumption of fork movement (Fig. S2), demonstrating that fork inactivation is a general feature of this class of helicases rather than an activity associated specifically with RecD2.

RecD2 Inactivates Paused but Not Elongating Replisomes.

Inhibition of resumption of fork movement upon dissociation of the protein–DNA block could be explained by RecD2-catalyzed inactivation of paused replisomes, of elongating replisomes, or both. To distinguish between these possibilities we assessed the impact of RecD2 on the activity of elongating and of paused forks in two parallel experiments. First, the effects of wild-type and pinless RecD2 were analyzed on elongating replication forks whose movement around a supercoiled plasmid template lacking engineered barriers was sustained by DNA gyrase (Fig. 2 A, ben). Addition of either wild-type or pinless RecD2 alongside the replication initiator DnaA had no significant impact on levels of DNA synthesis by elongating forks (Fig. 2 A, ii). Second, replication of the same supercoiled plasmid template was initiated by DnaA in the absence of a topoisomerase as in Fig. 1, resulting in fork stalling owing to topological strain (Fig. 2 B, ben). Subsequent addition of a restriction enzyme relieved the strain and allowed paused forks that retained function to continue (Fig. S1). However, addition of wild-type, but not pinless, RecD2 alongside the restriction enzyme inhibited subsequent DNA synthesis (Fig. 2 B, ii). RecD2 helicase activity results, therefore, in inactivation of forks paused by positive supercoiling. Taken together, the data in Fig. 2 indicate that RecD2 inactivates paused but not elongating replisomes.

RecD2 inactivates blocked but not elongating replication forks. (A, i) Method to analyze the impact of RecD2 on elongating replication forks. (A, ii) DNA synthesis in the presence of DNA gyrase upon simultaneous addition of DnaA with or without either wild-type or pinless RecD2, each present at 100 nM final concentration. (B, ben) Method to monitor the impact of RecD2 on the ability of forks stalled by positive supercoiling to continue DNA synthesis upon relief of topological strain. (B, ii) Levels of DNA synthesis upon addition of a restriction enzyme with or without either wild-type or pinless RecD2 (each at 100 nM).

RecD2 Inactivates Forks Paused by a Variety of Replicative Barriers.

Different obstacles have different impacts on replisome movement. Nucleoprotein complexes and topological strain require removal of the original block for resumption of replication (Figs. 1 and 2). In contrast, DNA lesions pause forks but can eventually be bypassed. A cyclobutane pyrimidine dimer within the leading strand template pauses fork progression, but leading strand synthesis can be reinitiated downstream of the lesion over the course of several minutes (11). We tested, therefore, whether RecD2 inhibited the ability of replisomes paused at a pyrimidine dimer to bypass the lesion and continue replication.

Reactions were again initiated in the absence of a topoisomerase followed by restriction enzyme cleavage in the presence of labeled deoxynucleotide to allow forks to progress. The plasmid template contained a single pyrimidine dimer within the leading strand template (11). Following restriction enzyme cleavage for 50 s, excess unlabeled deoxynucleotide was added with or without RecD2 or pinless RecD2 and incubation continued. One minute after addition of the restriction enzyme all reactions contained predominantly stalled replication forks (Fig. 3B, lanes 1, 5, and 9) (11). In the absence of RecD2 the majority of stalled forks generated full-length products after 8 min (Fig. 3B, lanes 1–4). Wild-type, but not pinless, RecD2 inhibited this conversion of stalled forks into full-length products (Fig. 3B, compare lanes 5–8 with 9–12, and 3C). RecD2 helicase therefore prevents replisomes paused by a DNA lesion from bypassing the DNA damage.

RecD2 inactivates forks paused by template lesions. (A) reaction scheme to monitor replication fork pausing at, and bypass of, a cyclobutane pyrimidine dimer (CPD) within the leading strand template. (B) Native agarose gel of replication products formed on plasmid DNA harboring a pyrimidine dimer within the leading strand template. Time points were taken 1, 2, 4, and 8 min after addition of restriction enzyme and radiolabel. Positions of replication forks stalled at the pyrimidine dimer and full-length products generated by bypass of the lesion are indicated. Wild-type and pinless RecD2 were present at 100 nM, as indicated. (C) Accumulation of full-length products as a function of time.

The data in Figs. 1–3 indicate that RecD2 helicase activity results in loss of function of paused, but not elongating, replisomes regardless of the nature of the replicative barrier.

Absence of Rep Helicase Hypersensitizes Cells to recD2 İfade.

Inactivation of paused but not elongating replication forks by RecD2 in vitro provides a potential tool to probe fork pausing in vivo. Conversion of paused forks that retain the ability to continue replication into inactivated forks that cannot continue upon removal or bypass of blocks might present viability problems, the severity of which would depend upon the frequency and duration of fork pausing. However, induction of recD2 expression from a plasmid-based arabinose-inducible promoter had no significant impact on viability as monitored by colony-forming ability (10) (Fig. 4 A ve B, ben). Chromosomal DNA content of wild-type cells induced for recD2 expression was affected significantly, however, as monitored by flow cytometry under run-out conditions (Fig. 4E, ben). Thus, RecD2 did have an impact upon chromosome duplication. This inhibition of chromosomal duplication required RecD2 helicase activity, not just DNA binding, because recD2pinless had no impact on DNA content (Fig. 4E, ii). Sensitivity to wild-type but not pinless RecD2 in vivo correlates with inactivation of paused forks by wild-type but not pinless RecD2 in vitro (Figs. 1C, 2B, and 3).

ifadesi recD2 is toxic in strains lacking Rep. (A) Colony-forming ability of wild-type E. koli (BW25113) and otherwise isogenic strains bearing single gene deletions upon expression of recD2 using a plasmid-based arabinose-inducible system (pMG31). Survival is represented by the number of colonies formed upon induction of recD2 expression relative to the number of colonies formed in the absence of induction. Table S2 gives strain numbers. (B) Colony-forming ability of temsilci + (TB28) and Δtemsilci (N6577) strains harboring pBADrecD2 and pBADrecD2pinless. (C) Colony-forming ability of temsilci + (MG1655), temsilci (N4982), and repK28R (SS1076) containing pBADrecD2. (NS) Colony-forming ability of temsilci + (MKG08) and repΔC33 (MKG10) upon recD2 overexpression (pMG31). (E) DNA content of (i and ii) wild-type (TB28) and (iii and iv) Δtemsilci (N6577) cells without and with induction of expression (unshaded and shaded histograms, respectively) from pBADrecD2 and pBADrecD2pinless as monitored by flow cytometry. DNA content with respect to number of chromosome equivalents per cell is indicated below. Note that Δtemsilci cells have a higher mean number of chromosomes per cell compared with temsilci + (compare the uninduced samples in i and ii with iii and iv), as noted previously (39).

The ability to survive recD2 expression could be due to repair of RecD2-inactivated forks providing an efficient means of surviving such inactivation. Recombination enzymes provide multiple pathways to repair damaged replication forks (24, 25). However, no significant impact on viability was observed in the absence of any recombination gene tested, suggesting that fork processing is not critical for survival of cells expressing recD2 (Fig. 4A ΔrecA, ΔrecB, and ΔrecF) (Table S1).

Alternatively, survival could reflect a low frequency and/or short duration of replication fork pauses in wild-type cells. Low levels of replisome pausing might be due to an inherently low frequency of pausing but might also be a consequence of multiple enzyme systems in wild-type cells that minimize fork pausing. We therefore analyzed the impact of recD2 expression in strains with a decreased ability to remove potential obstacles to replication. Lesions within the leading strand template cause replisome pausing before bypass of the lesion via repriming (11) (Fig. 3). However, absence of nucleotide excision repair did not render cells sensitive to RecD2 (Fig. 4A, ΔuvrA, ΔuvrB, and ΔuvrC). Absence of Mfd, a dsDNA translocase that promotes transcription-coupled repair of DNA lesions via UvrABC (26), also did not render cells sensitive to RecD2 (Fig. 4A). Thus, removal of bulky lesions from either nontranscribed or transcribed DNA was not required for tolerance of recD2 ifade. Similarly, absence of one or both of the apurinic/apyrimidinic endonucleases required for base excision repair did not result in hypersensitivity to RecD2 (Fig. 4A, ΔxthA ve Δnfo). Efficient removal of DNA lesions, and thus a reduction in their potential to pause forks, was not required therefore for tolerance of recD2 ifade.

Rep helicase provides another means to reduce fork pausing by acting at the replisome to disrupt nucleoprotein complexes ahead of the replication fork (10, 22, 27). Wild-type but not pinless RecD2 had a severe impact on colony-forming ability in the absence of Rep (Fig. 4 A ve B). Absence of Rep also caused hypersensitivity to T4 Dda (Fig. S3A). The toxicity of both RecD2 and Dda in Δtemsilci cells correlated, therefore, with the ability of both helicases to inactivate replisomes in vitro. The requirement for Rep to ameliorate the impact of RecD2 on colony-forming ability was dependent on Rep helicase activity, not just DNA binding, because a temsilci allele bearing a mutation in the Walker A motif was sensitive to RecD2 (Fig. 4C, iii). Thus Rep does not merely block access of RecD2 to a DNA substrate. Chromosomal DNA content upon recD2 induction in Δtemsilci cells was also reproducibly more severely affected compared with temsilci + cells (Figs. 4E, i ve iii ve 5E, ben ve F, ben).

RecD2-directed lethality is associated with transcription complexes. (AC) Colony-forming ability of temsilci + and Δtemsilci strains bearing either wild-type or mutant rpoB alleles upon no, low-, or high-level induction from pBADrecD2 (0%, 0.02% and 0.2% arabinose, respectively). Strains (i–viii) are TB28, N6577, PM486, N7604, AM2158, HB278, N7616, and HB280. (NS) Colony-forming ability of temsilci + and Δtemsilci strains bearing rpoB + or rpoB[H1244Q] upon induction of recD2 expression with 0.2% arabinose. Strain numbers are as in AC. (E ve F) DNA content of temsilci + and Δtemsilci strains bearing rpoB + , rpoB[H1244Q], or rpoB[G1260D] without and with induction of expression of recD2 with 0.2% arabinose (unshaded and shaded histograms, respectively). The number of chromosome equivalents per cell is indicated below. Note that both rpoB[H1244Q] ve rpoB[G1260D] also reduced the median number of chromosome equivalents in Δtemsilci cells in the absence of recD2 expression from eight to four, the same number as seen in temsilci + cells (F, karşılaştırmak ben ile birlikte ii ve iii). This may reflect suppression of the reduced rate of genome duplication in Δtemsilci cells (30). Strain numbers are as in AC.

Taken together, these data indicate that inactivation of paused but otherwise functional replisomes by RecD2 results in chromosomal defects that, although exhibited by wild-type cells, are exacerbated in the absence of Rep. The corollary of these observations is that many fork pausing events do not lead to replisome inactivation under normal circumstances in either temsilci + or Δtemsilci cells and that conversion of these paused forks into inactive forks by RecD2 is deleterious.

Clearance of Nucleoprotein Barriers Ahead of Forks Protects Against RecD2-Induced Cell Death.

Rep facilitates both clearance of nucleoprotein complexes ahead of forks (10, 22) and PriC-directed reloading of the replication apparatus (28, 29). However, the colony-forming ability of a strain lacking PriC was not reduced by RecD2 (Fig. 4A) or T4 Dda (Fig. S3B), indicating that failure of PriC-directed replisome reloading is not responsible for the inviability of Δtemsilci cells expressing RecD2.

Efficient clearance of nucleoprotein complexes ahead of forks by Rep is dependent upon not only Rep helicase activity but also a physical interaction between the C terminus of Rep and the replicative helicase DnaB (10, 30). A temsilci allele lacking the DnaB interaction domain but retaining helicase activity (temsilciΔC33) was sensitive to RecD2 expression (Fig. 4NS), consonant with efficient clearance of protein–DNA complexes ahead of forks being needed to minimize RecD2-induced viability defects. Both UvrD and DinG helicases have also been implicated in promoting replication of protein-bound DNA (10, 22), but neither helicase is known to associate physically with the replisome (31). aşırı ifadesi recD2 had no impact on colony-forming ability in the absence of either UvrD or DinG (Fig. 4A), supporting the conclusion that this toxicity is specific for the replisome-associated activity of Rep.

These data indicate that promotion of replisome movement by Rep along protein-coated DNA may be essential to avoid RecD2-directed cell death. A major source of nucleoprotein replicative barriers is transcription, with mutations within RNA polymerase subunits being able to suppress multiple defects in genome duplication (20, 32 ⇓ –34). One such mutation, rpoB[H1244Q], suppresses defects in genome duplication by reducing the stability of stalled transcription complexes (20) and inhibiting backtracking of RNA polymerase (35). We found that this mutation suppressed the RecD2-dependent killing of Δtemsilci cells as evinced by colony-forming ability (Fig. 5 AC, karşılaştırmak ben ve ii ile birlikte iii ve iv, and 5NS). Flow cytometry was also used to analyze DNA content. Although these analyses used rifampicin, an inhibitor of transcription initiation, to prevent replication reinitiation and simplify DNA content analysis, comparison of rpoB + with rpoB[H1244Q] revealed that rpoB[H1244Q] reduced the impact of RecD2 on chromosomal DNA content in both temsilci + ve Δtemsilci cells (compare ben ve ii in Fig. 5 E ve F). However, suppression by rpoB[H1244Q] in Δtemsilci cells was only partial, with both colony sizes reduced and DNA content still perturbed significantly by high level expression of recD2 (Fig. 5C, iii ve iv, ve F, ii).

Other mutations in rpo genes with the ability to suppress genome duplication defects also restored colony-forming ability to Δtemsilci cells, confirming that this suppression was not specific to rpoB[H1244Q] (Fig. 5B, v–viii). Aslında, rpoB[G1260D] (33) resulted in effective suppression of RecD2 toxicity even with high-level recD2 expression, as indicated by colony sizes and DNA content in Δtemsilci cells (Fig. 5C, karşılaştırmak v ve vi, and 5F, karşılaştırmak ben ve iii), suppression that was also apparent with dda expression in Δtemsilci cells (Fig. S3C). This suppression of toxicity suggested that transcription elongation factors might also provide a key means of ameliorating the consequences of paused fork inactivation. However, the simultaneous absence of four factors known to reduce RNA polymerase pausing and backtracking (26) did not render cells sensitive to recD2 expression (Fig. S4).

These data indicate that transcription complexes are the primary cause of RecD2-directed DNA content defects in both temsilci + and Δtemsilci cells and of lethality in Δtemsilci hücreler. Together with our demonstration that RecD2 inactivates paused forks in vitro, these findings indicate that the most significant cause of paused replisomes in otherwise unperturbed cells in vivo are transcription complexes. Moreover, the primary means of resuming replication from these paused replisomes is via an accessory replicative helicase.


Origin Usage

There exist more potential initiation sites in the genome than are activated during one normal S phase. For example, specificity of origin selection varies during embryogenesis or tissue development and during a fluorodeoxyuridine block or infection by polyomavirus or SV40, as revealed by the decrease in replicon size, suggesting an increase in the number of active replication origins. Clusters of origins and their associated replicons (replication units) are activated at different times throughout S phase in a defined spatial and temporal order.

Recent comparisons of origin activity among origins of DNA replication between normal human and tumour/transformed cells revealed an approximate 2- to 3-fold difference in the activation of replication origins, including origins containing the mammalian consensus sequence (Di Paola et al., 2006 ) as well as the c-myc origin and NOA3, an origin associated with the 3′ region of the ζ subunit of 14-3-3. Differential usage of origins (active and potential) may be important for the establishment and/or maintenance of different cell types, tissue-specific types and the processes of maturation or malignant transformation states. Also, a 400-bp replication enhancer within the ura4 origin region of sc. pombe defines the relative activities of three replication origins that are located in this region. This suggests that enhancers may influence the relative activities of individual origins found in the origin clusters of animal cells, thereby influencing origin efficiency and usage in different cell states.


Arka plan

Expression of a chromosomal gene in Escherichia koli can be elevated by gene amplification. The mechanism of this amplification is thought to consist of two steps, duplication and expansion. Duplication is rare, largely recA-independent, and occurs between microhomologies in the chromosome as a replication accident. Expansion is frequent, recA-dependent, and thought to result from unequal crossing-over events between the duplicated segments [1–3].

Recent investigations of gene amplification in E. koli have focused on amplification of plasmid-borne genes. A phenotypically leaky F'-borne mutation, ϕ(lacIX13-lacZ), gives rise to Lac + revertants bearing amplified arrays of 40–80 copies of the lak region [4]. Lac + revertants of F'lak bearing the +1 frameshift allele ϕ(lacI33-lacZ), extensively employed in studies of adaptive mutation, consist mainly of one-base deletions in runs of iterated bases [5, 6], but clones bearing amplified arrays appear at a lower rate as well [7, 8]. Properties of lak amplification have generally supported the duplication-expansion model. (i) An engineered duplication of the frameshift mutant lak locus amplifies at a greatly elevated frequency [9], as predicted by the idea that duplication is the rate-limiting step (and as had been seen in the case of chromosomal ampC [2]). (ii) Amplification is dependent upon recBCD ve ruvABC, birlikte recA, indicating an important role for homologous recombination [10].

Expansion of a pre-existing repeat has also been studied primarily on plasmids. In one study, a pBR322 derivative was constructed with two directly repeated tetA genes, each bearing an inactivating mutation, but arranged in such a way that a single unequal crossover would generate an array of three copies, one of which was a functioning gene. In this system, expansion was reduced only five-fold in a recA mutant expansion was elevated in strains bearing mutations in DNAQ, DNA, dnaB, veya dnaN [11].

Expansion of a pre-existing duplication was compared with amplification of a single copy of F'-borne ϕ(lacI33-lacZ) in another study [10]. Expansion was found to be increased in a polA mutant, and unaffected by overexpression of xonA, while amplification from a single copy was inhibited by both of these conditions. It was concluded that the amplification defects caused by the polA mutant and by xonA overproduction were in duplication, not expansion.

This study was undertaken to characterize expansion of a repeated sequence in the bacterial chromosome. A duplication of chromosomal ϕ(lacI33-lacZ) was constructed (Fig. 1). As expected, it expands at a high rate under selection for function. The effects of mutations in various recombination, replication, DNA repair, and stress response genes on expansion of the duplication were tested. The findings support the idea that expansion occurs via homologous recombination, and suggest as well that many of the recombination events leading to expansion take place at replication forks.

Expansion of a chromosomal duplication. A. Chromosomal (lacI33-lacZ)-lacY [38] was duplicated by phage λ Red-mediated recombination with a linear DNA bearing homology-flanked antibiotic resistance marker Ab. A hypothetical mechanism by which the duplication could be generated, involving crossovers between the linear DNA and both copies of the replicating chromosomal target, is diagrammed [9]. The duplication was constructed with a tetracycline resistance element, which was later replaced with kedi. Under selection for Lac function, the (lacIZ33Y)2-kedi duplication expands into multiple copies. L and R – chromosomal sequences flanking lak. E – EcoR1 restriction sites. B. Multiple copies of the repeated sequence are seen as bands produced by EcoR1 digestion of cellular DNA. Tests of two Lac + revertants, one without (-), and one with (+) an expanded lak array, are shown as examples.


Present address: Touchstone Diabetes Center, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA

These authors contributed equally: Dae-Seok Kim, Cristel V. Camacho

Bağlantılar

Laboratory of Signaling and Gene Regulation, Cecil H. and Ida Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA

Dae-Seok Kim, Cristel V. Camacho & W. Lee Kraus

Division of Basic Research, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX, 75390, USA


Videoyu izle: 5 แบบบานยงอย ยงจน รแลว แกดวน! (Mayıs Ayı 2022).